Eukaryon expression shuttle vector, construction method and application
A carrier and recombinant carrier technology, applied in the direction of using carrier to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, low connection efficiency, high cost, etc., and achieve the effect of simple process, improved level, and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the construction of pHP-DSV40
[0027] 1) Construction of pHP
[0028] Design primers pHP Vector1 upstream and pHP Vector1 downstream, pHP Vector2 upstream and pHPVector2 downstream, the sequences of primer pHP Vector1 upstream and pHP Vector1 downstream, pHP Vector2 upstream and pHP Vector2 downstream are as follows:
[0029] pHP Vector1 upstream: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG3';
[0030] Downstream of pHP Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG3'.
[0031] Upstream of pHP Vector2: 5'CTCGAGGATATCTGCA GATATOC AGCACAC3' (the underlined part is the EcoR V enzyme recognition site);
[0032] Downstream of pHP Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT3'.
[0033] Using the pEGFP-N1 (Invitrogen) plasmid as a template, use primers pHP Vector1 upstream and pHP Vector1 downstream to PCR amplify fragment A, and use pCDNA3.0 plasmid as a template, use primers pHP Vector2 upstream and pHP Vector2 downstream to PCR amplify fragment B.
[0034] PCR reaction sys...
Embodiment 2
[0061] Embodiment 2, the ability of pHP-DSV40 to express protein
[0062] 1) Construction of pHP-DSV40 expressing green fluorescent protein
[0063] Design primers EGFP upstream and EGFP downstream, primer EGFP upstream and EGFP downstream sequences are as follows:
[0064] EGFP upstream: GGAATTCTGCAGAT TCGCCACCATGGTGAG;
[0065] Downstream of EGFP: ATGCATGCTCGAGGATTTACTTGTACAGCTCG.
[0066] The GGAATTCTGCAGAT and ATGCATGCTCGAGGAT sequences in the primers are sequences capable of homologous recombination with the nucleotide sequence at positions 700-715 at the 5' end of sequence 1 and the nucleotide sequence at positions 716-730 at the 5' end of sequence 1 .
[0067] Using the pEGFP-N1 plasmid as a template, the EGFP gene fragment was amplified by PCR with primers EGFP upstream and EGFP downstream.
[0068] Reaction system: 5 μL of 10×PCR Buffer, 1 μL of upstream and downstream primers, 1 μL of DNA template, MgCl 2 (25mM) 3μL, dNTPs (2.5mM each) 3μL, Pfu-Taq (5U / μL) 0.5μL...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
