Rape mitogen-activated protein kinase gene and coding protein thereof
A technology for activating protein kinase and encoding protein, which is applied in the field of mitogen-activated protein kinase gene of rapeseed, can solve the problem that the specific function of rapeseed is not clear, and achieve the effect of obvious guiding effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] A cDNA sequence of rape (Brassica oleracea) mitogen-activated protein kinase gene (MPK4), which has the base sequence in the sequence table SEQ ID NO: 1; sequence characteristics: 1332bp, linear double strand, originally derived from Brassica napus Hu Oil 15 (Brassica napus H); the amino acid sequence of a Brassica napus (Brassica napus) mitogen-activated protein kinase gene (MPK4): it has the amino acid sequence of SEQ ID NO: 2 in the sequence table, linear, single-chain, and 373 amino acids.
Embodiment 2
[0024] Example 2 Gene Chip Differential Display Obtaining cDNA Fragment Sequence
[0025] Material
[0026] Rapeseed variety Huyou 15 was cultivated in the greenhouse until the seedlings had 4-5 leaves, sprayed 50 mg / L chitosan oligosaccharide on the leaves, and sprayed double distilled water on the leaves as a control, and collected materials within 1 hour.
[0027] Total RNA extraction, quantification and integrity testing
[0028] The dust on the leaf surface was washed with double distilled water, ground in liquid nitrogen, and RNA was extracted with TRIZOL (Gibco BRL) reagent. (1) Quantification: measure the absorbance at 260 and 280nm, and calculate A 260 / A 280 values to estimate the purity of total RNA. Pass A 260 Calculate the amount of total RNA from the value. (2) RNA integrity detection: separate total RNA on 1% formaldehyde denatured agarose gel, there are two clear bands, and the brightness of large molecular weight (28SrRNA) is approximately twice that o...
Embodiment 3
[0033] Example 3: Cloning of the 3' end
[0034] Use Takara's RNA PCR KIT (AMV) Ver.3.0 kit, use the primer TTGTATCAATTGTTGCGTGGA designed based on the cDNA fragment obtained above and the kit's own primer M13Primer M4, and use Takara's LA Taq enzyme to perform PCR (denaturation at 95°C for 5 minutes ; 92°C for 30 seconds, 52°C for 30 seconds, 72°C for 2 minutes as a reaction cycle, repeated 30 times; 72°C for 10 minutes;) The 3' end of this fragment was obtained. After agarose gel detection, the gel was recovered, and the recovered product was connected to the PMD 18-T carrier (Takara). The ligation product was transformed into E. coli Top10, screened by blue and white spots, and 10 white spot liquids were picked to expand culture and extract plasmids, denatured by PCR (95°C for 5 minutes; 92°C for 30 seconds, 52°C for 30 seconds, and 72°C for 2 minutes as one Reaction cycle, repeated 30 times; 72°C extension for 10 minutes;) After identification, sequenced by Shanghai Sango...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
