Process for the production of gamma-aminobutyric acid

[0046] 3.1 Dysregulation of other genes

[0047] Fermentative production of GABA using recombinant Corynebacterium glutamate producers expressing glutamate decarboxylase can be further improved if combined with dysregulation of at least one other gene as listed below.

[0048]

[0049] A preferred form of "amplified" is an "up" mutation that increases gene activity, for example gene amplification by using a strong expression signal and / or point mutations that increase enzymatic activity.

[0050] A preferred form of "attenuation" is a "down" mutation that reduces gene activity, eg gene deletion or dysregulation by using weak expression signals and / or point mutations that disrupt or reduce enzyme activity.

[0051] 3.2 Proteins of the invention

[0052] The invention is not limited to the specifically mentioned proteins, but also extends to functional equivalents thereof.

[0053] Within the scope of the present invention, "functional equivalents" or "analogues" or "functi...

[0209] Example 1: Cloning of the Escherichia coli glutamic acid decarboxylase (GAD) gene

[0210] PCR primers WKJ95 / WKJ96 and WKJ99 / WKJ100 were used to amplify the DNA fragments containing gadBC and gadA genes, respectively, using the chromosomal DNA of Escherichia coli as a template. The amplified DNA fragment was purified, digested with restriction enzymes XhoI / XbaI (for gadBC) and XhoI / SpeI (for gadA), and ligated into pClik5aMCS (SEQ ID NO: 14; image 3 ) vectors to obtain pClik5aMCSgadBC and pClik5aMCSgadA respectively.

[0211] Oligonucleotide primers used:

[0212] WKJ95 ccgctcgagcggcccaagcttcggtaaatacttataccggag (SEQ ID NO: 10)

[0213] WKJ96 ctagtctagactagcccaagcttgtcgatcatcgcctgttg (SEQ ID NO: 11)

[0214] WKJ99 ccgctcgagcggcccaagcttcgtgataaattgcgtcagaaag (SEQ ID NO: 12)

[0215] WKJ100 ctagactagtctagcccaagcttctcgaatttggcttgcatcc (SEQ ID NO: 13)

[0216] Example 2: Retrieval of the GAD gene in potato

[0217] To find the unknown gene encoding GAD in potato, the first step was to identify GAD in closely related organisms. A query for "glutamate decarboxylase" of Solanum in the sequence databases Genbank, Refseq and Uniprot revealed a previously characterized GAD in tomato, Swissprot accession number P54767. This sequence was used as a template for tblastn searches in Genbank plant subparts, EST and GSS. Among the 100 best hits (expected value -118 ), 16 sequences were from potato. All 16 sequences are expressed sequence tags (ESTs), ie fragments representing expressed and spliced ​​mRNA. Assembly using VectorNTI Contig Express (settings: overlap=20, identity=0.8, cutoff score=40) shows a contig consisting of 15 sequences, and a second contig consisting of 1 sequence ( BG594946).

[0218]To check the quality of the assembly and decide which contig to choose, the consensus sequence of the two assemblies was generated a...