Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
A growth hormone receptor and fish technology, which is applied in the direction of hormone receptors, biochemical equipment and methods, botany equipment and methods, etc., can solve problems such as inconsistent effects, and achieve high activity of signaling pathways, transgene-promoting Prominent growth effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Molecular Design of Recombinant Proteins for Sustained Activation of Recombinant Growth Hormone Receptor
[0059] Through protein structure prediction ( http: / / swissmodel.expasy.org / / SWISS-MODEL.html ) SWISS-MODEL program and protein structure analysis ( http: / / swissmodel.expasy.org / spdbv / )Swiss-PdbViewer program, based on our previous deep understanding of the GHR signaling pathway, molecularly designed a continuously activated recombinant growth hormone receptor molecule:
[0060] 1) Carp GHR signal peptide:
[0061] MAYSLSLGLLYLGLLCGNGLVSARSE
[0062] 2) Carp c-Jun leucine zipper region:
[0063] RIKAERKRLRNRLAATKCRKRKLERISRLEEKVKVLKNDNAGLSNTASVLRDQVAQLKQKV
[0064] 4) Carp GHR transmembrane region and intracellular region:
[0065] LRVAQIPSKESTFPTTLVLIFGVIGVVILLVLLIFSQQQRLMVIFLPPIPAPKIKGIDPELLKNGKLDQLNSLLSSQDMYKPDFYHEDPWVEFIQLDLDDPAEKNESSDTQHLLGLSRSGSSHFLNFKSDNDSGRASCYDPEIPNPKDLASFLPGHSGRGDNHPLVSRSSSSIPDLGFQQTSEVEETPIQTQPAVPSWVNMDFYAQVSDFTPAGGVVLSPGQLNSSPVKK...
Embodiment 2
[0068] Preparation of continuously activated GHR recombinant gene
[0069] 1) Primer design.
[0070] Primers for amplifying the GHR signal peptide:
[0071] F: CAGATCGATCACCCGGGAGCCACCATGGCTTACTCTCTCTCGCTC
[0072] R: TTTCCGCCTTGATGCGCTCGGATCTTGCAGACACCAG
[0073] Primers for amplifying the c-Jun zipper region:
[0074] F: CAAGATCCGAGCGCATCAAGGCGGAAAGGAAGAG
[0075] R: CTTGGTATCTGTGCCACTTCTCAGGACTTTCTGTTTGAGTTG
[0076] Primers for amplifying the GHR signaling region:
[0077] F: CCTGAGAGTGGCACAGATACCAAAGCAAAG
[0078] R: GTTCTCGAGATTCATGGGTTCAGGTTTCCCCAGAAG
[0079] 2) The GHR signal peptide, the c-Jun leucine zipper region, the GHR transmembrane region and the intracellular region were respectively amplified by PCR.
[0080] GHR signal peptide amplification conditions were: 95°C pre-denaturation for 4 minutes; 95°C for 30 seconds, 66°C for 30 seconds, 68°C for 30 seconds, 13 cycles; 68°C for 10 minutes; 4°C storage.
[0081] The c-Jun leucine zipper region amplificat...
Embodiment 3
[0088] A persistently activated growth hormone receptor gene in zebrafish.
[0089] 1) Preparation of transgenic zebrafish:
[0090] Taking zebrafish as the object, the zebrafish transfected with GHR gene was prepared continuously. After the expression vector pCA-SJG-AT was extracted by the plasmid miniprep kit (Axygen Company), the plasmid DNA was dissolved in ST solution (88mmol / l NaCl, 10mmol / l Tris-HCl, pH 7.5), and the final concentration was adjusted 85ng / μl, using the method of microinjection (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L.1758). Zangew Ichthyol, 1985, 1:31 -34), before the first cleavage, the DNA solution is introduced into the animal pole of the zebrafish fertilized eggs, the DNA injection dose is 1-2nl / egg, and the fertilized eggs after the micromanipulation is completed are incubated and cultured at a water temperature of 28.5°C.
[0091] 2) Screening of fast-growing fish transfected with pe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
