Modified mcry2Ab4 gene and its application
A technology of pet-2ab4 and gene, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as low protein expression, weak insect resistance, and difference in codon usage frequency
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1: Design and synthesis of new vip3Aa11 and cry2Ab4 gene (DNA) sequences and preparation methods thereof.
[0054] (1) Find the codons preferred by plants such as cotton, and while keeping the amino acid composition of the original Vip3Aa11 and Cry2Ab4 insecticidal proteins unchanged, replace the codons corresponding to the vip3Aa11 and cry2Ab4 genes with the codons preferred by the plant genes to obtain preliminary results Modified DNA sequence.
[0055] (2) Exclude AT-rich sequences and commonly used restriction endonuclease sites in the DNA sequence that cause the instability of plant gene transcripts, and then correct and eliminate them by replacing codons.
[0056] (3) Use computer software (DNAman) to analyze and eliminate large inverted repeats in genes by replacing codons.
[0057] (4) Add restriction enzyme recognition site sequences required for further cloning at both ends of the sequence.
[0058] (5) Determine the coding sequence of mvip3Aa11 gene as shown i...
Embodiment 2
[0084] Example 2: Expression, purification and insecticidal activity verification of optimized new genes mvip3Aa11 and mcry2Ab4 in E. coli
[0085] 1) Expression and purification of Cry2Ab4:
[0086] Analyzing the mcry2Ab4 gene sequence, designing a pair of primers based on the E. coli T7 expression vector pET21b cloning site, and introducing BamHI and EcoRI restriction sites on the two primers. A primer pair (2abup: CGC GGATCCGATGAATAGTGTATTGAATAGC / 2abdown CCG GAATTC AAACTTTAATAAAGTGGTG) was used to amplify the mcry2Ab4 gene, and the template was pUCCRY2AB. Amplification was performed according to the following parameters: 94°C pre-denaturation for 3 min; 94°C denaturation for 1 min; 53°C annealing for 1 min; 72°C extension for 3 min, 32 cycles; finally 72°C extension for 10 min. The polymerase is PFU polymerase.
[0087] The full-length cry2Ab4 gene was amplified by BamHI and EcoRI. The PCR product and vector pET-21b were digested with BamHI and EcoRI. After recovery, the PCR pro...
Embodiment 3
[0090] Example 3: Vip3Aa11 and Cry2Ab4 protein insecticidal activity verification and synergy analysis:
[0091] The Vip3Aa11 and Cry2Ab4 proteins expressed and purified in Escherichia coli were tested for their separate insecticidal activity and the combined use of 1:1 to determine the synergistic coefficient of the two proteins. The results showed that the combined use of the two proteins and the use of the two proteins alone had significant insecticidal effects on the cotton bollworm susceptible strain 96S and the resistant strain BtR. In the results using mortality as the evaluation standard (Table 4, showing the results of the synergy of the mortality measurement method), the synergistic values of the protein combination on the sensitive and resistant populations were 117.44% and 199.82, respectively, synergistically. The effect is remarkable. In the results of the evaluation standard based on the weight inhibition rate (Table 5, showing the results of the weight inhibiti...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
