Noninvasive chronic myelogenous leukemia susceptibility gene assay kit

[0020] Example 1. Use of detection kits

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTTCTATCCTTTG3'

[0026] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCCACA3'

[0027] (2) GSTT1 (Null / Present) forward primer: 5′TTCCTTACTGGTCCTCACATCTC3′

[0028] GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'

[0029] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;

[0030] The reaction conditions are: denaturation and enzyme activation at 94°C ...

[0043] Example 2. The service of non-invasive gene detection for preventing the onset of chronic myelogenous leukemia

[0044] 1. Sampling and DNA extraction

[0045] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0046] 2. Genotype detection

[0047] Using the kit provided by the invention, the ILe462Val site on the CYP1A1 gene of the subject's genomic DNA, whether the 2 single nucleotide polymorphism sites of the GSTT1 gene are missing (Null / Present) carry out DNA sequencing respectively, and determine these Genotypes of 2 SNPs loci.

[0048] 3. Risk assessment of chronic myelogenous leukemia high-risk groups

[0049] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of chronic myelogenous leukemia susceptibility genes is issued. The report details the ILe462V...