Method for quantitatively detecting hantaan virus load through one-step fluorescence probe real-time quantitative reverse transcription polymerase chain reaction
A technology of reverse transcription polymerase and fluorescent probe, applied in the direction of microbial measurement/testing, microbial-based methods, biochemical equipment and methods, etc. Beach virus and other problems, to achieve the effect of high sensitivity, reduced operation steps, high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0033] Example 1: Quantitative detection of Hantaan virus load in plasma of patients with hemorrhagic fever with renal syndrome:
[0034] Use the plasmid containing the 76-118S segment of the Hantaan virus standard strain to transcribe in vitro to obtain the S segment RNA of the 76-118 strain, quantify it accurately with an ultraviolet spectrophotometer, and calculate the molar concentration per unit volume based on its molecular weight as a standard; adjust the standard Concentration is 10 10 copies / ml, and 10 gradients were diluted 1:10 times as a standard curve.
[0035] After design and screening of primers and probes, the reverse transcription primers are random hexamers, in which:
[0036] The upstream primer is 5'-TACAGAGGGAAATCAATGCC-3';
[0037] The downstream primer is 5'-TGTTCAACTCATCTGGATCCTT-3';
[0038] The probe was 5'-(FAM)ATCCCTCACCTTCTGCCTGGCTATC(TAMRA)-3'.
[0039] Quantitative in vitro transcribed RNA was used as a standard, RNase-free water was used as...
PUM
| Property | Measurement | Unit |
|---|---|---|
| quality score | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com