Isolation and identification of Yunnan tomato leaf curl viral genome and agrobacterium tumefaciens-mediated infective clone construction

[0039] Example 1 Cloning and determination of Yunnan tomato leaf curl virus Y194 genome DNA

[0040] 1) Extraction of total plant DNA

[0041] Weigh 0.5-1.0 g of Yunnan tomato leaf curl virus-infected leaves in the field, add liquid nitrogen and grind to powder, quickly transfer the ground powder into 50 ml and add 4-8 ml of CTAB extract [containing 2% (v / v) 2-Mercaptoethanol (2-Me)] in a centrifuge tube. Heat in a water bath at 65°C, mix by inverting every 20-30 minutes, add an equal volume of 24:1 chloroform / isoamyl alcohol after 1 hour, mix by inverting up and down, and centrifuge at 10,000 rpm at 4°C for 5 minutes. Transfer the supernatant to another new 50 ml centrifuge tube, add 1 / 10 of the supernatant volume CTAB / NaCl and an equal volume of 24:1 chloroform / isoamyl alcohol, mix well, and centrifuge at 10,000 rpm at 4°C 5 min. Transfer the supernatant to another new 50 ml centrifuge tube, add 1 / 10 supernatant volume of 3 M NaAc (pH 5.2) and an equal volume of -20°C ...

[0044] Example 2 Construction of Infectious Clone of Yunnan Tomato Leaf Curl Virus Y194

[0045] Agrobacterium-mediated invasive cloning of geminivirus requires a full-length genome with more than 1.3-2.0 repeats and must include 2 intergenic regions (IR regions). Using viral genomic DNA as a template to contain Eco Y194EF (5'- GCGGAATTCCTTAAAGTGCTTTAG -3') and Y194ER (5'- TAGGAATTCATGGGAGCCCAAAG -3') at the R I single restriction site were used as primers, amplified by PCR and cloned into pGEM-T Vector to obtain pGEM-T-Y194, using Bam H I and Eco R I digested pGEM-T-Y194 to obtain 0.4 full-length DNA for insertion Bam H I and Eco The binary vector pBinPLUS obtained by R I double enzyme digestion was pBinPLUS-Y194-0.4A; Eco R I cut out a complete full-length DNA from pGEM-T-Y194 and inserted it into the corresponding site of pBinPLUS-Y194-0.4A to obtain an invasive clone of pBinPLUS-Y194-1.4A.

[0046] Example 3 Transformation of Agrobacterium by electric shock with recombinant vector

[0047] The recombinant plant expression vector was introduced into the Agrobacterium host cell EHA105 by electric shock. First, the competent cells of EHA105 need to be prepared. Pick a single colony of Agrobacterium EHA105 and inoculate it in 5 mL of YEP liquid medium containing 40 μg / mL rifampicin (Rif), culture at 28°C and 200 rpm until OD600≈0.6, collect enough bacteria with a 1.5 mL centrifuge tube, Centrifuge at 8,000 rpm at 4°C for 1 min, discard the supernatant; use 200 μL ddH 2 O was fully resuspended, centrifuged at 8,000 rpm at 4°C for 1 min, and the supernatant was discarded. After repeating three times, the supernatant was discarded; 2 O Sufficiently resuspended, namely Agrobacterium competent cells. Take 10 μL of the recombinant plasmid pBinPLUS-Y194-1.4A and add it to 200 μL of Agrobacterium tumefaciens competent cells, mix gently, transfer to an electric shock cup,...