Tobacco genome molecular marker probe and sequence collective group as well as acquiring method and application thereof
A genome sequence and molecular marker technology, applied in recombinant DNA technology, DNA preparation, DNA/RNA fragments, etc., can solve problems such as poor repeatability, low genetic diversity, and low reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035](1) Collect 24 tobacco cultivation samples, namely MSK326, MS Yunyan 85, MS Yunyan 87, Hongda, K346, V2, Yunyan 201, Yunyan 202, Yunyan 203, Yunyan 97, Yunyan 98, China Tobacco 100, PVH19, Yunyan 96, Yunyan 99, Yunyan 100, Yunyan 108, Yunyan 105, KRK26, YHO5, NC102, NC97, XYN87 and KRK28. Extract deoxyribonucleic acid (gDNA) from each sample.
[0036] (2) Treat each gDNA sample with a six-base restriction endonuclease PstI, add 500 ng gDNA samples to each 50 μL enzyme digestion reaction system, and add 30 units of restriction endonuclease PstI at 37 Digest the gDNA sample at ℃ for 3 hours.
[0037] (3) The digested gDNA sample was precipitated with isopropanol, then ligated with 1 × ligation buffer, 10 units of ligase and 50 ng of Pst I linker at 16°C for 45 minutes, with a total reaction volume of 30 μL.
[0038] (4) The Pst I linker sequence is as follows:
[0039] 5'-GTACATATTGTCGTTAGAACGCGTAATACGACTCACTATAGGGAGACTG-3'
[0040] 3'-CATGTATAACAGCAATCTTGCGCATTATGCTGA...
Embodiment 2
[0052] (1) A tobacco line (K326) was selected as the starting material. In order to keep its genetic background consistent, only a young leaf of a single plant was taken for tissue culture.
[0053] (2) The specific procedure is that after the leaves are divided into eight equal parts, each part of the leaves is individually cultured into seedlings.
[0054] (3) After 3 months of tissue culture on the young leaves of tobacco K326 above, the genomic gDNA was extracted from a single tissue culture plantlet in each bottle and stored in a -20°C refrigerator for subsequent genetic stabilization of tobacco MITE elements Sexual analysis experiments.
[0055] (4) Using the №:13 sequence in the sequence list as a template, a set of nested PCR primer combinations can be designed and completed, and its detailed sequence is as follows:
[0056] T9P1A Primer: 5'- GTGTCAACCGACACTCCTTCGTAGG -3'
[0057] T9P2A Primer: 5'- TGACACCCCTTGACTTCTTGGTGAG -3'
[0058] (5) Firstly, the first round ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
