Kit for detecting relevant expression quantity of AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site 1) fusion gene
A technology of relative expression and fusion gene, applied in the field of gene detection kits, can solve the problems of inferior specificity and high cost, and achieve the effects of simple operation, lower detection cost, and improved detection accuracy.
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The kit for detecting the relative expression of AML1-EVI1 fusion gene of the present invention comprises:
[0026] Red blood cell lysate;
[0027] TRIzol;
[0028] Chloroform;
[0030] Detection system PCR reaction solution: ReverTra Ace qPCR RT Kit (TOYOBO); THNDERBIRD Probe qPCR Mix (2×), AML1-EVI1 upstream and downstream primers 0.8 uM each, AML1-EVI1 probe 0.4 uM; abl upstream and downstream primers each 0.8uM, abl-probe (probe) 0.4uM;
[0031] Among them: AML1-EVI1-F: GACCATCACTGTCTTCA;
[0032] AML1-EVI1-R: AGTCTTCGCAGCGATAT;
[0033]AML1-EVI1-Probe: FAM-AATCACAGTGGATGGGCCCCGAG-TAMRA;
[0034] abl-F: GCCGTGAAGACCTTGAAGGAG;
[0035] abl-R: ATGATATAGAACGGGGGCTC;
[0036] abl-Probe: FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA;
[0037] Positive control substance: solution containing AML1-EVI1 genome; negative control substance: solution without AML1-EVI1 genome.
Embodiment 2
[0039] The using method of kit of the present invention:
[0040] (1) Extract tissue RNA from blood: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, stand at room temperature Centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall upside down gently; ...
Embodiment 3
[0050] Using the nucleic acid detection kit of the present invention to detect clinical specimens
[0051] A total of 80 cases of anticoagulated blood samples from patients with chronic myelogenous leukemia (CML) submitted for inspection were taken, and genomic RNA was extracted, reagents were prepared and tested according to the method described in Example 2.
[0052] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0053] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. Some positive results are as follows:
[0054] ...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
