Novel method for realizing secreting expression of exogenous protein by using novel transfer signal
A secretory expression and protein technology, which is applied in the field of secretory expression of exogenous proteins by using new transport signals, and can solve the problem of low secretion of exogenous proteins
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] 1. Obtaining of coding sequences of GroEL50, Eno50 and Hag50
[0023] Genomic DNA of the B. subtilis168 strain was extracted according to the instructions of the Bacterial Genome Rapid Extraction Kit. Corresponding primers were designed according to the published whole genome sequence of Bacillus subtilis 168, NdeI and EcoRI restriction sites were introduced into the upstream and downstream primers, respectively, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Using genomic DNA as a template, the corresponding coding sequence was amplified by PCR, and the amplified product was detected by agarose gel electrophoresis, and the size was consistent with the expectation. The polymerase used for amplification is KODplus from Toyobo (Shanghai) Biotechnology Co., Ltd. The primer sequences are as follows, where the underline represents the restriction site.
[0024] groEL-F: ATTC CATATG GCAAAAGAAATTAAGTTTAGT
[0025] groEL50-R: CCG GAATTC ATT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



