Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof
A technology of T5655C and mitochondria, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as troubles, and achieve the effects of pain relief, low cost, and simple detection process
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 A kit of the present invention
[0039] see figure 1 , the kit provided by the present invention consists of (1) DNA extraction mixture, (2) PCR mixture for amplifying T5655C fragment, (3) a pair of outer primers designed for T5655C, (4) a pair of inner primers designed for T5655C Primers, (5) restriction endonucleases, positive control 6, negative control 7 and cassettes. Among them, the DNA extraction mixture is mainly composed of cell lysate and solution I; composition; the PCR mixture 2 for amplifying the T5655C fragment includes dNTP (deoxygenated mononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq enzyme (DNA polymerase), a pair of outer primers 3 designed for T5655C have outer forward primer F: CTAACCGGCTTTTTGCCC (SEQ ID NO: 1) and outer reverse primer R: ACCTAGAAGGTTGCCTGGCT (SEQ ID NO: 2); designed for T5655C A pair of inner primers 4 has an inner forward primer F: AAGCCTAAGTAAGTTGC (SEQ ID NO:3) and an inner reverse primer...
Embodiment 2
[0041] Example 2 Carrying mitochondrial tRNA Ala Detection of essential hypertension families with T5655C mutation
[0042] 1. Test samples
[0043] see Figure 4 , A family with essential hypertension carrying the T5655C mutation was selected. This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 47, including 19 members of the maternal line, and 16 people suffering from high blood pressure.
[0044] 2. Extraction of Genomic DNA
[0045] Samples from 7 subjects were obtained respectively (including one drop of venous blood filter paper from capillaries collected from Ⅰ-2, Ⅱ-13 and Ⅱ-14; Ⅱ-1 and Ⅱ-2 were oral mucosa scrapings or saliva; Ⅱ-7 and Ⅱ-9 are hair with hair follicles), cut the blood filter paper into pieces with a size of about 1cm2 with clean scissors, put them ...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
