Method for separating and purifying inclusion body-type HIV-1 (human immunodeficiency virus-1) protease from prokaryotic system
A HIV-1, separation and purification technology, applied in biochemical equipment and methods, enzymes, hydrolases, etc., can solve the problems of low yield, complex purification process, etc., achieve small volume, high protease activity and purity, and dialysis process. mild effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Expression of HIV-1 protease
[0050] Design primers for PCR ( image 3 ) amplifying the HIV-1 protease coding fragment, recovering the PCR product and the pET-11a vector, digesting with Nde I and BamH I, recovering the target fragment, connecting the digested fragment with the linearized vector and transforming E. coli.DH5α competent cells. The transformed clones were picked for double-enzyme digestion identification, and the positive clones were subjected to DNA sequencing.
[0051] Table 1: PCR process
[0052] process temperature time pre-denatured 95℃ 10min transsexual 95℃ 30s annealing 55℃ 30s extend 72℃ 30s
[0053] PCR upstream and downstream primers are: no specific sequence listed,
[0054] 5'protease-11a-s ATCATATGGCCGATAGACAAGGAAC
[0055] 5'protease-11a-as GCGGATCCCTAAAAATTTAAAGTGC
[0056] Gene sequence of HIV-1protease:
[0057] GCCGATAGACAAGGAACTGTATCCTTTAGCTTCCCTCAGATCACTCTTT...
Embodiment 2
[0061] Example 2: Purification of HIV-1 Protease Inclusion Body
[0062] Suspend the expression bacteria collected by centrifugation in solution A (20mM Tris-HCl, pH8.0, 500mM NaCl, 2mM EDTA), add nuclease DNase I, and use a low-temperature ultra-high pressure cell disruptor (Guangzhou Juneng Biotechnology Co., Ltd.) Lyse the cells, adjust the high-pressure bacteriostasis instrument to 1200bar, repeatedly pressurize the bacterial solution 3 times, then add 2% TritonX-100 and 2% Tween20 to the bacterial solution, stir evenly, and use ultrasonic (Scientz-IID ultrasonic cell disruptor) ) treatment, ultrasonic power 300W, on for 4s, off for 6s, ultrasonic for 20min, then centrifuged at 15000rpm / min for 30min to collect the precipitate, HIV-1 protease exists in the precipitate in the form of inclusion body. Wash the precipitate with 50ml solution B (20mM Tris-HCl, pH8.0, 500mM NaCl, 2mM EDTA, 2% TritonX-100, 2% Tween20), method: resuspend the precipitate evenly with solution B unti...
Embodiment 3
[0064] Example 3: Refolding of inclusion body protein by dialysis
[0065] Test material: dialysis bag, purchased from Beijing Baierdi Biotechnology Co., Ltd., dialysis bag D21mm (dialysis molecular weight 3500).
[0066] Treatment before use:
[0067] 1. Cut the dialysis bag into small pieces of 10-20cm.
[0068] 2. Boil the dialysis bag in 2% (W / V) sodium bicarbonate, 1 mmol / L EDTA (pH 8.0) for 10 minutes.
[0069] 3. Rinse the dialysis bag thoroughly with double distilled water.
[0070] 4. Boil the dialysis bag in 1 mmol / L EDTA (pH 8.0) for 10 minutes.
[0071] 5. Thoroughly wash the dialysis bag with double distilled water and store at 4°C. Make sure that the dialysis bag is always submerged in the solution. Gloves must be worn when handling the dialysis bag after handling.
[0072] 6. The dialysis bag can be stored in 20% ethanol at 4°C for a long time. Before use, fill the dialysis bag with water and drain it to clean it.
[0073] Dilute the protein solution with ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
