Method of promoting generation of lateral buds of Heveabrasiliensis by trans-AtWUS (Arabidopsisthaliana WUSCHEL) gene
A rubber tree and gene technology, applied in the field of plant genetic engineering, can solve problems such as difficulty in lateral buds, achieve the ability to promote, and promote the effect of somatic embryogenesis or organogenesis in rubber trees
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] 1) Arabidopsis AtWUS gene cloning and plant expression vector construction, the Arabidopsis AtWUS gene was cloned, and pCAMBIA2301-35s-AtWUS plant expression vector was constructed;
[0058] Weigh 0.5 g of fresh leaves of Arabidopsis thaliana, extract Arabidopsis RNA, and synthesize cDNA using the Transtart IIFirst-strand cDNA synthesis supermix kit, design a pair of specific primers according to the ORF of the AtWUS gene with the accession number NM_127349 in NCBI, and the upstream primer is WF:5' CGGGATCCCGATGGAGCCGCCACAGC3', the downstream primer is WR: 5'GCGAGCTCGCCTAGTTCAGACGTAGCTCAAGAGAAG3', add a BamHI and SacI restriction site at the 5' end of the upstream and downstream primers;
[0059] Using the synthesized AtWUS cDNA as a template, WF and WR as specific primers, PCR (polymerase chain reaction) was used to amplify the AtWUS gene, and the PCR product was observed by agarose gel (1.0%) electrophoresis and gel imaging system, excised Weigh the target fragment wi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
