A kind of artificial cultivation method of wild leather ear
A technology of wild leather ear and artificial cultivation, applied in cultivation, plant cultivation, mushroom cultivation and other directions, can solve the problem of no report of wild leather ear, and achieve the effects of faster fruiting, better quality and better quality.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: use the present invention to carry out the artificial cultivation of wild leather ear
[0035] (1) According to mass percentage, it is 20% of potato, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate and trace vitamin B1, and the rest are made of water. Atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;
[0036] (2) According to the mass percentage, it is composed of 20% of potatoes, 2% of glucose, 2% of agar, 0.5% of peptone, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amount of vitamin B1, and the rest is water to make the isolated parent species Medium slope, 0.11MPa atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;
[0037](3) The raw material composition of the original seed material is 38%-42% of cottonseed hulls, 36%-40% of sawdust, 18%-20% of bran, and 1%-2% of calcium ca...
Embodiment 2
[0049] (1) According to mass percentage, it is 20% of potato, 2% of glucose, 2% of agar, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate and trace vitamin B1, and the rest are made of water. Atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;
[0050] (2) According to the mass percentage, it is composed of 20% of potatoes, 2% of glucose, 2% of agar, 0.5% of peptone, 0.3% of potassium dihydrogen phosphate, 0.15% of magnesium sulfate, trace amount of vitamin B1, and the rest is water to make the isolated parent species Medium slope, 0.11MPa atmospheric pressure, 121 ℃ high temperature and high pressure damp heat sterilization for 30 minutes;
[0051] (3) The raw material composition of the original seed material is 38%-42% of cottonseed hulls, 36%-40% of sawdust, 18%-20% of bran, and 1%-2% of calcium carbonate by mass percentage. Raw material composition Weigh each component, soak cottonseed hulls in water ov...
Embodiment 3
[0062] Embodiment 3: the identification of wild leather ear
[0063] Large-scale fungal resource collection and investigation were carried out in Dinghushan National Nature Reserve in Zhaoqing, Guangdong, and a fungus of the genus Panus was obtained. On the rotting wood of the forest, its PDA pure culture was obtained by tissue separation, its fruiting body was obtained through the artificial domestication cultivation method of embodiment 1, the fruiting body of domestication was sampled respectively, and its gills and stipe tissue were obtained, and low temperature (40 ℃) drying, using liquid nitrogen to grind, using the Ezup column type fungal genome DNA extraction kit (Sangon Bioengineering (Shanghai) Co., Ltd.) to extract the DNA genome, the obtained DNA solution (DNA template) -20 ℃ Refrigerate and set aside.
[0064] The ITS-PCR experiment was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



