Rapid construction method and applications of conditional gene knockout animal model
A construction method and gene knockout technology, applied in the field of gene editing, can solve the problems of high cost, complicated operation, long period of homozygous mice, etc., and achieve economic cost reduction, avoid hybridization process, and shorten the period of gene knockout. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Designing gRNA targets for mouse GGCX
[0036] Referring to the gRNA design principles, design gRNA1 and gRNA2 targets for the first and second exons of γ-glutamate carboxylase (GGCX), respectively, and the sequences are as follows:
[0037] gRNA target 1: GAGCAACCAGTGCGGAGCCG (as shown in SEQ ID NO.1)
[0038] gRNA target 2: GCCAGGTTTGCAGGGTCCGT (as shown in SEQ ID NO.2)
[0039] Details such as figure 1 shown.
[0040] Construction of gRNA vector
[0041] 1. Digestion of gRNA empty vector
[0042] The empty gRNA vector was purchased from Addgene. gRNA empty vector ligated in -Blunt II- in the carrier. Digest with Afl II enzyme (NEB), and recover fragment 1 from the gel.
[0043] gRNA empty vector sequence: as shown in SEQ ID NO.3.
[0044] 2. Construction of gRNA target sequence inserts
[0045] 1) Design primer sequences as follows:
[0046] gRNA1 upstream primer gRNA1-F (as shown in SEQ ID NO.4):
[0047] 5'-TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
