Dna sequence and expression vector for circular rna expression and application thereof
A technology of DNA sequence and expression vector, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic material. The result is a stable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Construction of pcDNA-circRNA1730 overexpression plasmid
[0052] 1. Primer design:
[0053] Download the linear sequence of the hsa_circ_0001730 circular RNA from the CircBase database:
[0054] >hsa_circ_0001730|NM_004444|EPHB4
[0055] GTACTAAGGTCTACATCGACCCCTTCACTTATGAAGACCCTAATGAGGCTGTGAGGGAATTTGCAAAAGAGATCGATGTCTCCTACGTCAAGATTGAAGAGGTGATTGGTGCAGGTGAGTTTGGCGAGGTGTGCCGGGGGCGGCTCAAGGCCCCAGGGAAGAAGGAGAGCTGTGTGGCAATCAAGACCCTGAAGGGTGGCTACACGGAGCGGCAGCGGCGTGAGTTTCTGAGCGAGGCCTCCATCATGGGCCAGTTCGAGCACCCCAATATCATCCGCCTGGAGGGCGTGGTCACCAACAGCATGCCCGTCATGATTCTCACAGAGTTCATGGAGAACGGCGCCCTGGACTCCTTCCTGCGG
[0056] Primer design with Primer5 software:
[0057] circRNA1730-F: 5' GGGGTACCGTACTAAGGTCTACATCGACCCCTT 3'
[0058] circRNA1730-R: 5' GCTCTAGACCGCAGGAAGGAGTCCAG 3'
[0059] The primer sequences were synthesized by Shanghai Jierui Company.
[0060] 2. PCR catch gene:
[0061] PCR reaction system, 50 ul in total:
[0062] 2mM dNTP 5ul
[0063] 10×KOD buffer 5u...
Embodiment 2
[0157] Example 2: Construction of pLL-circRNA1730 lentivirus and its stable cell line
[0158] 1. Lentiviral packaging
[0159] 1) 24 hours before transfection, 293T cells in the logarithmic growth phase were digested with trypsin, passaged to a 10 cm cell culture dish, and cultured in a 37°C, 5% CO2 incubator. After 24 h, the cells were ready for transfection when the cell density reached 70%-80%. Cell state is critical for virus packaging, so good cell state and low passage times need to be guaranteed.
[0160] 2) Replace the cell culture medium with serum-free medium before transfection.
[0161] 3) Add the prepared DNA solutions (10 μg of pLL-circRNA1730 vector, 5 μg of pGag / Pol vector, 5 μg of pRev vector, and 5 μg of pVSV-G vector) into a sterilized centrifuge tube, and mix well with the corresponding volume of Opti-MEM , to adjust the total volume to 1.5 ml.
[0162] 4) Shake Lipofectamine 2000 reagent gently, take 60μl Lipofectamine 2000 reagent and mix with 1.5ml ...
Embodiment 3
[0183] Embodiment three: QPCR detection
[0184] 1. RNA extraction
[0185] 1) Cell treatment: Add 1ml Trizol to each well of a 6-well plate, pipette repeatedly 10 times with a 1ml pipette tip, collect into an EP tube; centrifuge for 15 minutes at 12000g, and take the supernatant.
[0186] 2) Add 200ul chloroform to the supernatant, mix vigorously up and down for half a minute, and let stand for 3 minutes.
[0187] 3) Centrifuge at 12000g for 15 minutes at 4°C. At this time, it can be seen that the lysate is divided into three layers: the upper layer is RNA in the aqueous phase; the middle layer is DNA, lipids, etc.; the lower layer is cell residues, proteins, polysaccharides, etc.
[0188] 4) Take 500ul of the supernatant into a new EP tube, pipette 167ul three times; add an equal volume of isopropanol, mix well, let stand for 10 minutes, then centrifuge at 12000g for 10 minutes at 4°C.
[0189] 5) Carefully remove the supernatant and be careful not to lose the RNA pellet. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



