Method for measuring ABCC2 gene polymorphism

[0047] Example 1: Detection of ABCC2c.1249G>A (rs2273697) Gene Polymorphism Using High Resolution Melting Curve Analysis Technology

[0048] 1. Design primers:

[0049] Retrieve the sequence information of the human ABCC2c.1249G>A (rs2273697) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains the target sequence of the gene of interest A sequence consisting of 18-27 bp continuous nucleotides, the length of the PCR product is 80-150bp.

[0050] The sequence of the ABCC2c.1249G>A (rs2273697) gene:

[0051] rs2273697-F:TCAATCCTTATCTTTAGGCAT

[0052] rs2273697-R: ACAGTATCGCATTAATTGGG

[0053] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;

[0054] The test uses TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to supplement the P...

[0062] Example 2: Detection of ABCC23972C>T (rs3740066) gene polymorphism using high-resolution melting curve analysis technology

[0063] 1. Design primers:

[0064] Retrieve the sequence information of human ABCC23972C>T (rs3740066) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains 18- in the target sequence of the gene of interest A sequence composed of 27 bp continuous nucleotides, the length of the PCR product is 80-150bp;

[0065] The sequence of the ABCC23972C>T(rs3740066) gene is:

[0066] rs3740066-F: CAAATGATGAAGGCTTAGGG

[0067] rs3740066-R:CTGGGTGACTGATAAGAGGC

[0068] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;

[0069] Choose TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to make up the PCR reaction syste...