Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC
A technology of puc19-atti-400-attc and puc19-attl-400-attc, which is applied in the direction of introducing foreign genetic material using a vector, recombinant DNA technology, etc., can solve the failure of the in vitro activity assay method of bacterial drug resistance integrase, etc. problem, to achieve the effect of easy screening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] In order to make the objects and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0034] like Figure 1-2 As shown, the construction method of the drug-resistant Escherichia coli integrase integration vector pUC19-attI-400-attC comprises the following steps:
[0035] S1. Using 440DNA as a template, PCR amplification was performed with the following primers to obtain 440bpinsertion;
[0036] F: CGGGATCCAGGGCGAGGAGCTGTTCACC;
[0037] R: ACGCGTCGACGTTGTGGCTGTTGTAGTTG;
[0038] The PCR reaction system is:
[0039] 10×PCRBuffer2.5μL; dNTP(2.5mM)1.6μL; primersF(5P)
[0040] 1 μL; primersR (5P) 1 μL; Taq (5U / μL) 0.125 μL; ddH2O 16.775 μL; DNA 2 μL;
[0041] S2. Using the attI and attC sequences reported by NCBI as templates, d...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
