Molecular improvement method for lowering rice grain seed holding
A technology of rice shattering and rice, which is applied in the field of rice biotechnology breeding, can solve the problems of reduced harvest yield, easy grain drop, and loss of harvest yield due to shattering, so as to save time and cost, reduce genomic DNA damage, and improve improvement The effect of work efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] The present invention will be further clarified through the detailed description of specific embodiments below, but it is not intended to limit the present invention, but only for illustration.
[0030] The present invention uses the CRISPR / Cas9 system to target and modify the rice shattering gene qSH1 to reduce the molecular genetic improvement method of rice (indica rice variety R1128) shattering, which includes the following steps:
[0031] 1) According to the Nipponbare qSH1 reference sequence, the double-stranded fragment of the indica rice R1128qSH1 coding region was cloned and sequenced;
[0032] 2) According to the above sequencing and splicing results, design two target sequences in the R1128qSH1 coding region and the upstream region of the 5' end of the start codon:
[0033] Target-qSH1-1 (SEQ ID NO.1): GCGCCATGTCGTCCGCCGCT
[0034] Target-qSH1-5 (SEQ ID NO.2): ACATGGCGCGCACGCACGTA
[0035] The above two target sequences both contain 5'-(N) X -NGG-3' st...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
