Hepatoprotective activity and new medical application of glycyrrhiza inflata extract and licochalcone A
A kind of licorice, active technology, applied in the application field of acute liver injury
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1, DNA variety identification of Glycyrrhiza inflate.
[0035] 1. Experimental materials and methods.
[0036] The total DNA of the sample was extracted with a plant genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing), and its ITS sequence and trnH-psbA transcribed spacer sequence were amplified by PCR and sequenced. The primer sequences are: ITS-F, GAAGGATCATTGTCGATGCC; ITS-R, GCGTTCAAAGACGCCTATTGG; trnH-forward, ACG GGA ATT GAACCC GCG CA; Gly-trnHR1, CAT ATG ACT TCA CAA TGT AAA ATC.
[0037] Second, the experimental results.
[0038] The DNA variety identification results of Glycyrrhiza inflate are as follows: figure 1shown. According to the corresponding relationship between licorice varieties and genotypes summarized in the literature (Kondo K, Biol Pharm Bull 2007, 30, 1497-1502), the ITS genotype of this sample is I-2 type, trnH-psbA is T-3 type, Therefore, it was identified as licorice bloating.
Embodiment 2
[0039] Example 2, component analysis of Glycyrrhiza inflate and preparation of Glycyrrhiza inflate extract and LCA.
[0040] 1. Experimental materials and methods.
[0041] All chemical reagents mentioned in this method were purchased from Beijing Chemical Plant.
[0042] Preparation of extract: Weigh 20kg of dried root of Glycyrrhiza inflata, and crush it. Add 5 to 10 times the amount of 95% ethanol, heat to reflux for 3 to 4 hours, and filter with suction. The filter residue was extracted once with 95% and 75% ethanol respectively according to the above method. The extracts were combined, concentrated under reduced pressure until there was no alcohol smell, and the total extract was obtained, which was the ethanol extract of Glycyrrhiza inflata. The extract is suspended with an appropriate amount of deionized water, and extracted 4 times with 2 to 3 times the amount of ethyl acetate. The ethyl acetate is recovered to obtain the extract of the ethyl acetate part.
[0043...
Embodiment 3
[0054] Example 3, the activating effect of Glycyrrhiza inflata extract and licorice chalcone A on Nrf2.
[0055] 1. Experimental materials and methods.
[0056] HepG2 cells were stably transfected with Nrf2 luciferase reporter gene using Lipofectamine 2000 (Life Technologies), and the resulting cells were called HepG2C8 cells. HepG2C8 cells were cultured in MEM medium with 10% fetal bovine serum, maintained at 37 °C, 5% CO 2 Saturated humidity, digested and passaged with 0.25% trypsin-EDTA, press 2×10 5 12 hours after each well was inoculated in a 24-well plate, the culture medium was sucked off, and the drug was administered.
[0057] Administration treatment: 500 μL of MEM medium containing 2.5 μM, 5 μM, 10 μM, 20 μM, 40 μM licochalcone A or 50 μg / mL licorice extract was added to each well, and 2 auxiliary wells were paralleled. To the blank group, 500 μL of MEM medium containing the same amount of DMSO was added. Incubate for 6 hours.
[0058] Reporter gene detection: ...
PUM
| Property | Measurement | Unit | 
|---|---|---|
| wavelength | aaaaa | aaaaa | 
Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



