CRISPR/Cpf1 plant genome directional modification function unit, carrier comprising function unit, and application thereof
A plant genome and functional unit technology, applied in the field of CRISPR/Cpf1 plant genome directed modification functional unit, can solve the problems of low shear editing efficiency, limited CRISPR/Cpf1 research, poor genetic stability, etc.
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] Example 1 Construction of CRISPR / Cpf1 Plant Genome Directed Modification Backbone Vector
[0074] The invention relates to a CRISPR / Cpf1 genome directional modification backbone carrier for plant genome engineering, the core of which comprises a Cpf1 nuclease protein expression unit and a guide crRNA transcription expression cloning unit. The Cpf1 nuclease protein expression unit consists of a Pol Ⅱ type promoter, a Cpf1 protein coding frame (including the nuclear localization signal NLS), and a transcription terminator. The crRNA transcription and expression cloning unit is composed of PolⅡ type promoter, HH ribozyme, crRNA cloning unit (BsaI-ccdB-BsaI unit fused at the 3' end), HDV ribozyme, and Nos transcription terminator element in sequence.
[0075]The Cpf1 nuclease protein coding gene (LbCpf1, whose nucleotide sequence is as Seq ID No.5) of Lachnospiraceae bacterium ND2006 is fused to the nuclear localization signal (NLS) at the 5' end and the 3' end respectively...
Embodiment 2
[0077] Example 2 Directed modification of rice endogenous gene OsPDS based on CRISPR / Cpf1 system
[0078] 1. Design of rice OsPDS gene guide crRNA and construction of Cpf1+crRNA recombinant expression vector
[0079] Based on the rice OsPDS sequence (NCBI No. NM001055721) as the reference sequence, based on the 73bp-99bp (Seq IDNo.7: TTTG GAGTGAAATCTCTTGTCTTAAGG, the underline is the PAM site) region, design OsPDS-crRNA01 (Table 1). Table 1 Design, synthesis and detection information of rice OsPDS gene guide crRNA
[0080]
[0081] According to the designed OsPDS-crRNA01 site nucleic acid sequence, artificially synthesize the corresponding forward and reverse oligonucleotide chains, the specific sequence is as follows (uppercase base sequence represents the designed site-specific guide crRNA site; lowercase base sequence represent cohesive ends complementary to the backbone vector):
[0082] OsPDS-crRNA01-F:agatGAGTGAAATCTCTTGTCTTAAGG (Seq ID No.11);
[0083] OsPDS-crR...
Embodiment 3
[0093] Example 3 Directed Modification of Rice Endogenous Gene OsDEP1 Based on CRISPR / Cpf1 System
[0094] 1. Design of rice OsDEP1 gene guide crRNA and construction of Cpf1+crRNA recombinant expression vector
[0095] Based on the rice OSDEP1 sequence (NCBI No. FJ039904) as the reference sequence, according to the 3241BP-3267BP (SeqID No.14: TTTG CTACTGTTGCAAGTGCTCACCCCA, the underline is the PAM site) region and 2745BP-2771BP (Seq ID No.15: TTTC CAGAAAGAGAAGGAGGCACAGAT, the underline is the PAM site) region, and OSDEP1-crRNA01 and OSDEP1-crRNA02 were designed respectively (Table 3).
[0096] Table 3 Design, synthesis and detection information of rice OsDEP1 gene guide crRNA
[0097]
[0098] According to the designed nucleic acid sequences of OsDEP1-crRNA01 and OsDEP1-crRNA02 sites, artificially synthesize the corresponding forward and reverse oligonucleotide chains, and the specific sequences are as follows (the uppercase base sequence represents the designed site-sp...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



