Application of hsa_circRNA_102032 to liver cancer diagnosis, treatment and prognosis
An RNA primer, liver cancer technology, applied in the application field of circular hsa_circRNA_102032, can solve the problems of unexplained pathogenesis, pathological diagnosis and limitations of treatment methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] In the course of research on liver cancer, a circular RNA was discovered. Its sequence is:
[0025] CTAGAGTTGGGAAGACATCACTGATTATGTCTCTGGTCAGTGAAGAATTTCCAGAAGAGGTTCCTCCCCGGGCAGAAGAAATCACCATTCCAGCTGATGTCACCCCAGAGAGAGTTCCAACACACATTGTAGATTACTCAGAAGCAGAACAGAGTGATGAACAACTTCATCAAGAAATATCTCAGGCTAATGTCATCTGTATAGTGTATGCCGTTAACAACAAGCATTCTATTGATAAGGTAACAAGTCGATGGATTCCTCTCATAAATGAAAGAACAGACAAAGACAGCAG(SEQ ID NO:1),将其命名为hsa_circRNA_102032。
experiment example 2
[0026] Experimental example 2 materials and processing:
[0027] 1) Collection of peripheral blood samples
[0028] Specimens were collected from patients who underwent PLC liver transplantation 1 day before, 1 day after, 3 days after, and 7 days after surgery in the Nephrology Department of the No. For the peripheral blood of healthy volunteers with normal physical examination, 0.5ml of each sample was collected in a 0.5ml cryopreservation tube and stored in a -80°C refrigerator for future use. All research subjects gave informed consent to participate in this experiment, and the process was reviewed and approved by the hospital ethics committee.
[0029] 2) Sample preparation and evaluation
[0030] RNA sample preparation
[0031] In the experiment, patients with liver cancer were divided into 1 day before liver transplantation group, 1 day after operation, 3 days after operation, 7 days after operation group and healthy control group.
[0032] Take 2ml of mixed whole bl...
experiment example 3
[0040] Experimental Example 3 Real-time fluorescent quantitative PCR detection
[0041] Primer design
[0042]According to the comparison between the preoperative group (preoperative 1 day group) and the healthy control group and the postoperative group (postoperative 1 day, 3 day, 7 day group) compared with the preoperative group, or the comparison between the preoperative group and the healthy control group The screening principle of down-regulation and up-regulation in the postoperative group compared with the preoperative group randomly selected verified circRNAs for fluorescence quantitative verification. The fold difference was calculated by 2-ΔΔCt method and detected by RT-PCR. The PCR primer sequences are as follows:
[0043] Table 1 RT-PCR primer list
[0044]
[0045] RT-PCR for verification
[0046] RT-PCR was used for verification. To establish an 8 μL system, add 5 μL of 2×Master Mix, 0.5 μL of forward and reverse primers, and 2 μL of distilled water. Add...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



