Detection method of RNA G-quadruplex
A quadruplex and sulfur technology, which is applied in the field of RNAG-quadruplex detection and detection kits for RNAG-quadruplex, can solve the problems to be improved, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1 prepares sample
[0061] The samples used in the following examples are as follows:
[0062] Sample 1: RNA G-quadruplex sample, the RNA G-quadruplex used in the following examples is also called VEGF, and VEGF has the nucleotide sequence shown in SEQ ID NO:1.
[0063] GGAGGAGGGGGAGGAGGA (SEQ ID NO: 1).
[0064] VEGF was synthesized by Guangzhou Ruibo Biological Co., Ltd. Dissolve VEGF in Tris-HCl (containing K + ) solution, the final concentration of VEGF was 20 micromole / liter, and after heating to 90° C., and then naturally cooling down to room temperature, sample 1 was obtained.
[0065] Sample 2: single-stranded RNA sample, the single-stranded RNA used in the following examples is also called Af22, and Af22 has the nucleotide sequence shown in SEQID NO:2.
[0066] UGAGCUUAAUUGUAUAUAUAUUCG (SEQ ID NO:2).
[0067] Af22 was synthesized by Guangzhou Ruibo Biological Co., Ltd., and Af22 was dissolved in Tris-HCl (containing K + ) solution, the final co...
Embodiment 2
[0071] Embodiment 2 detects RNA G-quadruplex
[0072] 1. Preparation of reaction solution (solution A, solution B, solution C)
[0073] 1) Solution A
[0074] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 20 μL of 20 μmol / L sample 1 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution A, wherein the molar ratio of RNA G-quadruplex to Thioflavin T was 0.5:1.
[0075] 2) Solution B
[0076] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 20 microliters of 20 micromol / liter sample 2 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T was 0.5:1.
[0077] 3) Solution C
[0078] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use ...
Embodiment 3
[0092] Embodiment 3 detects RNA G-quadruplex
[0093] 1. Preparation of reaction solution (solution A, solution B, solution C)
[0094] 1) Solution A
[0095] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 1 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mix well to obtain solution A, wherein the molar ratio of RNA G-quadruplex to Thioflavin T is 1:1.
[0096] 2) Solution B
[0097] Add 4 μl of 200 μmol / L high-purity aqueous solution of Thioflavin T to a 2 mL reaction tube, then add 40 μL of 20 μmol / L sample 2 (pH 7.2), and then use Tris-HCl (containing K + ) to 400 microliters, and mixed to obtain solution B, wherein the molar ratio of single-stranded RNA to Thioflavin T was 1:1.
[0098] 3) Solution C
[0099] Add 4 microliters of 200 micromol / liter high-purity aqueous solution of Thioflavin T to a 2mL reaction tube, and then use Tris-HCl (containing K + ) soluti...
PUM
| Property | Measurement | Unit |
|---|---|---|
| strength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



