Primer probe, kit and method for accurate and quantitative detection of internal standard of transgenic rice
An internal standard gene, primer probe technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Accurate and specific quantitative results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] For the first time, the inventors of the present invention amplified the internal standard gene SPS of transgenic rice by real-time fluorescent PCR (probe method). Transgenic rice internal standard gene SPS primer probe sequence used is upstream primer RB-F2 CTAGAGGATCCCGGACGAGTG (SEQ ID No.1), downstream primer RB-R2ATGAGTGGTAGCGTCCAGAAGGAAA (SEQ ID No.2); the probe is RB-P2CTGGGGCAGATAAGCAGTAGTGGTGGG (SEQ ID No. .3).
[0028] 1. Main testing instruments used:
[0029] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.
[0030] 2. Main reagents for detection:
[0031] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.
[0032] 3. Main steps of detection:
[0033] Real-time fluorescent PCR reaction system:
[0034] 2×Mastermix 12.5μL
[0035] Upstream primer (10mM) 1.0μL
[0036] Downstream primer (10mM) 1.0μL
[0037] Pro...
Embodiment 2
[0048] In this example, the gene copy number of transgenic rice is quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice SPS strain. The probe sequence of the transgenic rice SPS strain-specific primer used is the upstream primer SPS-F1 GAGAACAAGAAGCCCCTTCTGTCTCG (SEQ ID No.1), and the downstream primer is SPS-R1AAGGTACTAAAGCTTGAAAATCCTAAGGC (SEQ ID No.2); the probe is SPS - P1CACATTCGGCAGTGAAACTCTTGAGCGCC (SEQ ID No. 3).
[0049] 1. Main testing instruments used:
[0050] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12000 r / min), etc.
[0051] 2. Main reagents for detection:
[0052] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.
[0053] 3. Main steps of detection:
[0054] Digital PCR reaction system:
[0055] 2×Mastermix 10 μL
[0056] Upstream primer (10mM) 1.0μL
[0057] Downstream primer (10mM) 1.0μL
[0058] Probe (10mM) 0.5μL
[0...
Embodiment 3
[0067] The same as the method described in Example 2, except that the genomic DNA of the transgenic rice sample was first diluted 5 times and then diluted 10 times in 3 gradients as a template, and each dilution gradient was repeated 3 times, using transgenic rice SPS amplification primers The probe sequence was the same as that in Example 2, and quantitative detection by digital PCR was carried out to determine the sensitivity of the method.
[0068] When the blank control (sterile double distilled water) had no amplification signal, the contents of the stock solution and its diluted 2, 4, 8, 16, and 32 times were 1845.3, 987.0, 480.0, 245.3, 123.3, 62.2 copies / μL, respectively, The deviations are far less than 20%, which are -0.53%, 6.42%, 3.5%, 5.79%, 6.35%, and 7.3%, respectively. The quantitative actual value basically conforms to its theoretical copy value, and the droplet distribution diagram of each concentration gradient has negative points Can be better distinguished...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com