Application of rv1773c in the preparation of anti-mycobacterium tuberculosis infection medicine
A technology of Mycobacterium tuberculosis, rv1773c, applied in the field of drug application, can solve problems such as drug resistance and aggravating the burden on patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] [Example 1] Construction and identification of recombinant expression plasmids of 18 ORFs in M.tb RD10-16 region and recombinant mycobacteria
[0021] Extract the H37Rv genome, design primers for the H37Rv RD10-16 region (Table 1), and amplify the corresponding genes. The specific steps are as follows: use the bacterial genomic DNA extraction kit to extract the H37Rv genome as a template for PCR reactions. PCR system and process of RD10-16 region gene: 1 μL each of primers P1 and P2 (concentration is 10 μM), genomic DNA 1 μL (concentration is 105 ng / μL), 2×Mix 25 μL, add sterile deionized water to a final volume of 50 μL . The PCR amplification conditions are: under the action of Taq DNA polymerase, pre-denaturation at 95°C for 4 minutes; denaturation at 95°C for 20 s, annealing at 58°C for 30 s (the temperature of this step is fine-tuned according to the annealing problem of the primers of each gene), and extension at 72°C for 30 s for a total of 30 s. cycle; the fina...
Embodiment 2
[0026] [Example 2] Distribution of Rv1773cc in RD14 region in different mycobacteria
[0027] Using each mycobacterial genome as a template, Rv1773c-specific primers P1: 5'CGGATCCTTGGGTTCAACAGGAGG3' (containing the BamHI restriction site), P2: 5'ATTAAGCTTCGCCGCCGCATG3' (containing the HindIII restriction site) were used for PCR. Detect the expression of Rv1773c in different mycobacteria, such as figure 1 As shown, Rv1773c is mainly highly expressed in H37Rv and H37Ra, lowly expressed in Mycobacterium intracellulare and Mycobacterium avium, and not expressed in Mycobacterium smegmatis, Mycobacterium marinum and BCG.
Embodiment 3
[0028] [Example 3] Screening and identification of Rv1773c in the RD14 region significantly promotes the invasion of Mycobacterium tuberculosis to macrophages
[0029] A 24-well cell plate was spread with RAW264.7 cells (the cell density was 2×10 5 / well), in a 24-well plate, rM.s::Rvs was infected with RAW264.7 macrophages at an MOI of 10:1 for 30 minutes, followed by gentamicin for 1 hour to remove and kill extracellular non-invasive The bacteria were cultured in a cell incubator (wild-type M.s and rM.s::pMV261 control groups were set). Wash 3 times with sterile PBS, scrape it off with a cell scraper, transfer to a 1.5ml EP tube, and centrifuge at 300g to discard the supernatant to remove excess bacteria or cell debris that may remain. 200 μl of 0.02% Triton-x-100 cell lysate was used to resuspend the cell pellet after centrifugation in the previous step. After 3 minutes of action, the pellet was collected by centrifugation at 12,000 rpm / min, that is, the mixture of cell deb...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



