Application of phage Vp670 perforin gene holA
A perforin and gene technology, applied in phage, virus/phage, applications, etc., can solve problems such as mutation of the action site, achieve the effect of reducing workload and improving screening efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Bioinformatics analysis of holA and cwlQ
[0026] The phage Vp670 genome was sequenced by the inventor and published in GenBank (KY290756.1). The genome sequence of Vp670 was annotated by RAST ( http: / / rast.nmpdr.org / ), the analysis found that orf3 encodes a hypothetical protein, searched by Blastp ( https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ) found that the orf3 encoded product has only 49% identity with the amino acid sequence of the closest phage perforin, but the orf3 encoded product has a conserved domain of phage perforin, orf3 is named holA, and its sequence is as shown in the sequence table SEQ ID As shown in No. 1 (specifically: GTGAGTGAAAAGATTGTAAAAGCAGTAGAGGTAGTCCGTGAGACTCTACCAGCAGCGCCACCTGCGGCGTATGTTGGTATGAAGTTCTACGGCATCTCTTTGCCAGATATAGTATCTATAGCTACTCTGATATACTTAGTTATACAGATTGGCTACATTCTTTATAAGTGGAGAAAGGGGATTTAA), the expression product is named as HolA, and its amino acid sequence is shown in No. 2 of the sequence table.
[0027] Using TMHMM ( ...
Embodiment 2
[0029] Embodiment 2: construct the expression plasmid of perforin gene (holA) and endolysin gene (cwlQ)
[0030] In order to explore the functions of perforin HolA and endolysin CwlQ and the synergistic relationship between them, the plasmid pBAD18-kan was used to construct the fragments containing only cwlQ (the nucleotide sequence of which is shown in SEQ ID No.3), containing only The holA fragment (its nucleotide sequence is shown in SEQ ID No.1) and the recombinant plasmid containing the fusion fragment of endolysin cwlQ and holA two genes.
[0031] Primers used for PCR amplification of cwlQ gene:
[0032] Endolysin-F: GCGAATTCGAGCTCGGTACCAGGAGGAATTCACCATGTTCGTTGAAGCAATTCT
[0033] Endolysin-R: CCAAGCTTGCATGCCTGCAGTCAAGGTCTTCCTCCATTATC
[0034] Primers used for PCR amplification of holA gene:
[0035] holin-F: TTACAATCTTTTCACTCACGTTCAAGGTCTTCCTCCATTATC
[0036] holin-R: GATAATGGAGGAAGACCTTGAACGTGAGTGAAAAGATTGTAA
[0037] To construct a recombinant plasmid containing t...
Embodiment 3
[0045] Embodiment 3: Construction of Vibrio alginolyticus controllable expression bacteria of perforin gene (holA) and endolysin gene (cwlQ)
[0046] Vibrio alginolyticus E06333 was cultured in brain heart infusion medium (BHI) overnight at 30°C. The above four plasmids (pBAD18-kan, pBAD18-holA, pBAD18-cwlQ, pBAD18-holA-cwlQ) were respectively electrotransformed into Vibrio alginolyticus E06333, and the method of electrotransformation was included in the inventor's published patent (CN104195073A). Electric shock voltage 1.8kV, electric shock time 1ms. After the electric shock, the cell suspension was quickly added to the BHI medium (BD) containing 0.3% D-Glu, and the culture was resumed at 30°C for 1 hour. After the culture solution was diluted 10 times and 100 times, 100 μl was respectively applied to LB plates containing Kan resistance. , after culturing overnight at 30°C, colonies were picked and cultured in liquid BHI containing kanamycin (Kan) resistance for 12 hours. S...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



