Sanfilippo B syndrome lentiviral vector, lentivirus and preparation method and application thereof
A technology of lentiviral vector and syndrome, which is applied in the field of preparing drugs for the treatment of Gaucher disease, can solve the problems that the clinical effect of disease treatment cannot meet expectations, affect the effect of disease treatment, and the difference in gene transfer efficiency, etc., and achieve strong stability, Good safety and the effect of improving safety performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] The construction of embodiment 1 lentiviral vector
[0068] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:
[0069] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:
[0070] Modification of the 5' splice donor site:
[0071] Wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;
[0072] Mutant (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;
[0073] (2) Insertion of promoter and NAGLU gene:
[0074] Synthesize the normal NAGLU gene sequence (as shown in SEQ ...
Embodiment 2
[0079] Preparation and identification of embodiment 2 lentivirus
[0080] 1) Preparation of lentivirus
[0081] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:
[0082] (1) The lentiviral vector constructed in Example 1 and the packaging helper plasmid pNHP and pHEF-VSV-G were co-transfected into mammalian cells HEK293T and cultured for 24-72h;
[0083] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.
[0084] 2) Identification of lentivirus
[0085] The collected neuron cells and glial cells after transfection with normal NAGLU gene lentivirus were identified for protein expression, so as to clarify the expression of NAGLU gene in neuron cells.
[0086] From the results, there is no expression of NAGLU protein in the negative control cells of neuron cells without lentivirus transfec...
Embodiment 3
[0088] The therapeutic effect of embodiment 3 lentivirus
[0089] The lentivirus carrying normal NAGLU prepared in Example 2 is directly injected into the brain to treat Sanfilippo B syndrome disease. The schematic diagram of the treatment process is as follows Figure 4 As shown, the injection site of the lentiviral vector and the specific coordinates of the brain are determined by MRI or CT of the brain, and the lentiviral vector carrying the normal NAGLU gene is directly injected into the brain of the patient for disease treatment. .
[0090] It can be seen from the results that after direct injection of lentivirus, the transfer efficiency and expression level of NAGLU gene in the brain can be effectively improved.
[0091] In summary, the lentiviral vector of this application can directly repair the damaged NAGLU gene in cells, and can effectively improve the transfer efficiency and expression level of NAGLU gene in the brain, which is of great significance to ensure the ef...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



