Broad-spectrum anti-apoptosis rhabdovirus expression vector
A technology of baculovirus and expression vector, which is applied in the direction of antiviral agent, virus/bacteriophage, virus, etc., and can solve the problem of no baculovirus expression vector
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0024] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.
[0025] According to the consensus sequence SEQ ID NO:1 of Sf-caspase-1 and Tn-caspase-1, the present invention designs two target sites of RNAi:
[0026] gccgcactgagacagatggct (563-583)
[0027] gcactgagacagatggctcac (566-586)
[0028] Design four siRNA coding sequences according to these two target sites (DNA sequences are: SEQ ID NO:4 + loop +SEQ ID NO:2 + TTTTT and SEQ ID NO:5 + loop + SEQ ID NO:3 + TTTTT ):
[0029] 563-4T: gctgtattgagatagatggctgcttattaaagccatctgtctcagtgcggcttt...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com