Production method of recombinant strain expressing ETX-CSA at same time and vaccine related to recombinant strain

[0097] Embodiment 1, the construction of the recombinant Escherichia coli BL21-pET-EA expressing ETX-CSA simultaneously

[0098] 1. Design primers

[0099] According to the nucleotide sequences of Clostridium perfringens epsilon toxin and Clostridium putrefaction α toxin published on NCBI, primers were designed respectively, and a linker was added. The linker sequence was "GGTGGCGGGGGTAGCGGCGGTGGCGGTTCTGGTGGCGGTGGCTCC". The designed primers are shown in Table 3.

[0100] Table 3 Target fragment amplification and plasmid construction primer list

[0101]

[0102]

[0103] 2. Amplification of the target fragment

[0104] 1. Separate amplification of two target fragments

[0105] The PCR reaction system is shown in Table 4.

[0106] Table 4 PCR reaction system 1

[0107] total capacity

50μl

2×A8 FastHiFi PCR MasterMix

25μl

Type D Clostridium perfringens C60-3 genome or Clostridium putrefaction C55-1 genome

1μl

F_32acpe (for am...

[0127] Example 2, Induced expression and high-density fermentation of recombinant Escherichia coli BL21-pET-EA containing recombinant plasmid pET-EA

[0128] The solvent of MDG non-inducing medium is water; the solute and concentration are: 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mMNH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glucose, 2.5g / L aspartic acid, ampicillin 100μg / mL, pH is 7.4. The medium formula comes from this article, F William Studier.Stable Expression Clones and Auto-Induction for Protein Production in E.coli[J].Methods in Molecular Biology,2014,1091:1-17.

[0129] The solvent of ZYM-5052 self-induction medium is water; the solute and concentration are: 10g / L casein peptone, 5g / L yeast extract, 25mM Na 2 HPO 4 , 25mM KH 2 PO 4 , 50mM NH 4 Cl, 5mM Na 2 SO 4 , 2mM MgSO 4 , 5g / L glycerol, 0.5g / L glucose, 2g / L α-lactose, ampicillin 100μg / mL, pH 7.4. The medium formula comes from this article, FWilliam Studier.Stable Expression Clones and Auto-Induction fo...

[0140] Example 3, the immune effect of the vaccine made by the high-density fermentation of recombinant Escherichia coli BL21-pET-EA on animals

[0141] 1. Seedling making

[0142] Take the bioreactor culture obtained in Example 2, add formaldehyde solution (containing 40% formaldehyde, % represents mass fraction) amount according to 0.4% of the total volume, and inactivate at 37° C. for 48 hours. After passing the inactivation and detoxification test, prepare the vaccine with the antigen (bioreactor culture after the above-mentioned inactivation): aluminum glue (product of SPI Pharma company, item number is VAC 20HA) ratio is 4:1 (volume ratio), so that The final concentration of the target protein (fusion protein shown in SEQ ID No.1) in the obtained vaccine was 300 μg / mL.

[0143] 2. The immune effect of the vaccine on rabbits

[0144] Before immunization, 5 mL of blood was collected from the middle artery of the ear of each rabbit, and the serum was separated, and the ne...