LRSAM1 gene SNP mutation site genotyping primer and application thereof in predication of coronary heart disease

[0039] Example 1, a susceptibility gene for coronary heart disease is the LRSAM1 gene. A test sample containing the gene of LRSAM1 can be obtained from the blood of the subject.

[0040] Embodiment 2, a reagent for in vitro detection of coronary heart disease-related genes, the reagent is used to detect the SNP genotype of the LRSAM1 gene rs3802358 site, the reagent includes the following primers and probes:

[0041] Upstream primer sequence 5'ATCCTGAAATGTAAGCAAATGACTGT3' (SEQ ID No.1);

[0042] Downstream primer sequence 5'GCCAGGATCCAGCCAGGTA3' (SEQ ID No.2);

[0043] G-type probe sequence 5'VIC-CCACACATACGGCTG-MGB3' (SEQ ID No.3);

[0044] Type A probe sequence 5'FAM-CCACACATATGGCTG-MGB3' (SEQ ID No.4).

[0045] The so-called SNP is single nucleotide polymorphism, which mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable variation in humans, accounting for more than 90% of all known polymorphisms. Some SNPs will directly affect the protein structure or gene expression level, and may themselves be candidate alteration sites for the genetic mechanis...

[0048] Embodiment 3, a preparation or kit with reagents for in vitro detection of coronary heart disease-related genes is characterized in that the kit includes PCR amplification enzyme (ie, DNA polymerase) and corresponding buffer. The kit for detecting coronary heart disease-related genes with rs3802358 polymorphism can be used for in vitro detection of coronary heart disease-related gene polymorphisms; the kit for coronary heart disease-related genes with mutations at rs3802358 can be used for detection, prevention, Diagnosis or treatment of coronary heart disease; the method for detecting coronary heart disease-related genes in vitro can be used for detection, prevention, diagnosis or treatment of coronary heart disease.