Pyruvate kinase gene and application thereof
A kind of pyruvate kinase, gene technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] The present invention discovers a pyruvate kinase gene MtPK1, the gene sequence of which is shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, ATG is the start codon and TGA is the stop codon. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. Its use is heterologous expression of pyruvate in other organisms, and overexpression in Medicago truncatula can produce flavonoids.
[0025] The identification method of pyruvate kinase gene of the present invention comprises the following steps:
[0026] (1) Cloning of the full-length fragment of the MtPK1 gene
[0027] PCR reactions were performed according to the Phusion high-fidelity DNA polymerase instructions provided by Thermo Fisher Scientific (Table 1, Table 2).
[0028] Table 1 Phusion enzyme reaction system
[0029]
[0030] The sequence of the Forward primer is: ATGATGGCAGAGAAGAAACC; the sequence of the Reverse primer is: TCATTTCACAGTCAAGATTTTG
[0031] Table 2. PCR pro...
Embodiment 2
[0071] According to the annotations in NCBIgenbank and KEGG SSDB databases, the full-length sequences of 13, 10 and 12 pyruvate kinases were obtained from Arabidopsis thaliana, rice and Medicago truncatula, respectively, for sequence alignment and evolution analysis.
[0072] DNAMAN was used for amino acid sequence homology comparison analysis, and the conserved domains contained in it were analyzed according to the Pfam 31.0 database; a phylogenetic tree was constructed using the Neighbor-joining method using Mega7 software.
[0073] In the present invention, bioinformatics analysis is carried out on the amino acid sequence encoded by MtPK1. The amino acid sequence of MtPK1 and its homologous protein were subjected to multiple sequence alignment analysis, and the results of the comparison analysis are shown in figure 1 , figure 1 The β barrel and α / β domains of pyruvate kinases are at amino acid positions 8-350 and 367-493, respectively; solid lines represent the conserved d...
Embodiment 3
[0076] The coding sequence of MtPK1 was cloned with primers MtPK1SalF and MtPK1BamR with restriction enzyme sites, and the PCR product was digested by SalI and BamHI and connected into the same restriction enzyme digested vector pJIT163-hGFP to construct the fusion gene MtPK1- hGFP. The correctly sequenced constructs were introduced into Arabidopsis leaf protoplasts. Incubate at 25°C for 16 hours, detect fluorescence with a Leica laser scanning confocal microscope, and use pJIT163-hGFP as a positive control.
[0077] In order to further confirm that MtPK1 belongs to cytoplasmic pyruvate kinase, the present invention constructed a transient expression vector of MtPK1-hGFP fusion expression driven by the CAMV 35S promoter, and transformed it into protoplasts of Arabidopsis mesophyll cells, and observed it with a Leica laser confocal microscope Localization of fluorescent proteins. The green fluorescent signal of GFP in the cytoplasmic region is clearly visible, whereas the aut...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



