Supercharge Your Innovation With Domain-Expert AI Agents!

Improved L-lysine fermentation preparation method

A technology of lysine and methylase, which is applied in the field of fermentation and production of L-lysine and bacteria, can solve the problems of no enlightenment to transform the efficiency of DNA methylase L-lysine, and achieve the effect of increasing production

Active Publication Date: 2019-06-25
NINGXIA EPPEN BIOTECH
View PDF12 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] None of the above literatures on the production of L-lysine suggested that the modification of DNA methylases (especially adenine-specific DNA methylases) or their genes could improve the efficiency of L-lysine production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved L-lysine fermentation preparation method
  • Improved L-lysine fermentation preparation method
  • Improved L-lysine fermentation preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 NCgl0866 Gene expression downregulation experiments

[0039] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl0866 Primers for fragments at both ends of the gene coding region, as upstream and downstream homology arm fragments. Primers were designed as follows (synthesized by Shanghai Yingjun Company):

[0040] P7: 5' CGGAATTCGATGCCTGC GGGATGACGA 3' (BamH1)

[0041] P8: 5'GATGACGAAG GAGCCCCTAT CCAGAGCCAC CAAACCTGGG ACG3'

[0042] P9: 5'CGTCCCAGGT TTGGTGGCTC TGGATAGGGG CTCCTTCGTC ATC3'

[0043] P10: 5' CGGGATCCCCTAAACCCTGTCTCAAAATCAC 3' (EcoR1)

[0044] Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P7 / P82 and P9 / P10 respectively to obtain a 680bp upstream homology arm fragment and a 800bp downstream homology arm fragment, and then OVER PCR with primers P7 / P10 to obtain The entire homology arm fragment is 148...

Embodiment 2

[0049] Embodiment 2 Lysine fermentation experiment

[0050] The strains and original strains constructed in Example 1 were carried out in a BLBIO-5GC-4-H type fermenter (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 1 and the process shown in Table 2. Fermentation experiments. Each strain was repeated three times, and the results are shown in Table 3.

[0051] Table 1 Fermentation medium formula

[0052]

[0053] Table 2 Fermentation process

[0054]

[0055] Table 3 Experimental results of lysine fermentation

[0056]

[0057] The results are shown in Table 3, in Corynebacterium NCgl0866 Carrying out point mutations contributes to the improvement of L-lysine production.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an improved L-lysine fermentation preparation method. The method comprises the step of modifying a gene encoding DNA methylase on a chromosome of a corynebacterium bacterium, and reducing the activity and / or expression of the DNA methylase; and, fermenting the bacterium obtained by the modification to produce lysine. In addition, the present invention also provides a methodand an application derived from the method, as well as bacteria and the like that can be used in the method and the application.

Description

technical field [0001] The invention belongs to the field of amino acid fermentation, in particular, the invention relates to methods and applications for fermentative production of L-lysine, and bacteria that can be used in these methods and applications. Background technique [0002] Production of L-lysine by fermentation of L-lysine-producing bacteria (eg, Escherichia coli of the genus Escherichia and rod-shaped bacteria of the genus Corynebacterium) has been industrially applied. These bacteria can be bacteria isolated from nature, bacteria obtained through mutagenesis or genetic engineering, or both. [0003] L-lysine-producing bacteria include bacteria of the genus Corynebacterium. For example, Chinese patent CN1017906B discloses a method for producing L-lysine, including using Corynebacterium bacterium containing recombinant DNA for synthesizing dihydrodipyridinecarboxylic acid synthase and / or succinyltetrahydropyridinecarboxylic acid synthetase to ferment A step of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/08C12N1/21C12R1/15
Inventor 孟刚
Owner NINGXIA EPPEN BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More