SSR reagent kit capable of rapidly identifying opium poppy
A kit and poppy technology, applied in the field of SSR kits for rapid identification of poppies, can solve problems such as the difficulty of detecting similar poppies, achieve rapid and reliable identification, high specificity, and avoid interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Screening and optimization of SSR-specific molecular markers for poppy identification
[0063] 1. The applicant downloads the poppy genome and the entire EST sequence from NCBI, excavates the SSR sites of different repeating units, and designs primers; uses the designed and synthesized primers to perform PCR amplification on poppy and its close relative species, and the amplification is stable and specific Sites with strong specificity, fragment size between 100-350bp and fragment size difference of 20-60bp constitute a specific primer set; fluorescently labeled M13 adapters are used in PCR amplification to effectively reduce costs.
[0064] The sequence of the specific primer set obtained by screening is:
[0065] M13: GTAAAACGACGGCCAGT;
[0066] P1F: GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC;
[0067] P1R: CTCTGCACGATGAAGCTGAC;
[0068] P2F: GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC;
[0069] P2R: AATCCTCGGCTGAGCTTACA;
[0070] P3F: GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC;...
Embodiment 2
[0076] Application of SSR Specific Primer Set in Poppy Species Species Identification
[0077] 1. Collection of plant samples of opium poppy and its related species
[0078] On the intraspecies level, opium poppy samples were provided by Wuhan Botanical Garden of the Chinese Academy of Sciences, the First Research Institute of the Ministry of Public Security and other relevant units. The origins are: Wuhan, Hubei, Duerbert Mongolian Autonomous County, Heilongjiang, Heze, Shandong, Changqing, Shandong, and Myanmar; At the same time, the collected poppy samples included individuals with variations in flower color (red, pink, purple, white, etc.), flower shape (single and double) and number of pods (single and multiple).
[0079] At the interspecific level within the genus, samples of 7 species and 2 variants of the genus Papaver were collected, and each species collected as many individuals as possible from different populations in its distribution area.
[0080] At the intra-f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



