Construction method for taurine transporter gene knockout rat model based on CRISPR/Cas9 technology
A gene knockout, rat model technology, applied in the field of bioengineering, can solve the problem of no literature report on pathophysiological research
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] 1. Materials and methods
[0033] 1.1 Experimental animals
[0034] The rats required for the experiment were SPF grade SD rats, weighing 240-260 g, purchased from Beijing Huafukang Biotechnology Co., Ltd.
[0035] 1.2 Method
[0036] 1.2.1 Knockout of taurine transporter gene (TauT - / - ) Construction and breeding of SD rats
[0037] Taut - / - The SD rat model uses CRISPR / Cas9 gene editing technology to select two different sgRNA targets for the fifth exon of the TauT gene (Slc6a6), and synthesizes two pairs of oligonucleotide chains.
[0038] Among them, the two pairs of oligonucleotide chains are:
[0039] Rat-Slc6a6-gRNA1-up:TAGGCCCCTTTGTCCCACAGAC, its nucleotide sequence is shown in SEQ ID NO:1
[0040] and Rat-Slc6a6-gRNA1-down: AAACGTCTGTGGGACAAAGGGG, the nucleotide sequence of which is shown in SEQ ID NO: 2;
[0041] Rat-Slc6a6-gRNA2-up:TAGGGACAGACCCTGTCTCTGG, its nucleotide sequence is shown in SEQ ID NO:3
[0042] and Rat-Slc6a6-gRNA2-down:AAACCCAGAGACAG...
Embodiment 2
[0083] 2. Results
[0084] 2.1 Construction and reproduction of rats
[0085] Using CRISPR / Cas9 system to knock out the target gene, the Slc6a6 gene undergoes a frameshift mutation, and a stop codon is generated in advance, so that the translation is terminated early, resulting in protein dysfunction, such as figure 1 shown.
[0086] After about 15 months, 23 litters were bred from the F1 and F2 generations, and the total number of F1-F3 generations was 186. Homozygosity appeared in the F3 generation, and the homozygosity rate of this generation was about 20.59%.
[0087] F3 Generation TauT + / + : TauT + / - : TauT - / - The ratio is about 1:2.57:1.28, approximately satisfying the Mendelian law of inheritance. During the breeding process, 14 adult mice died, the mortality rate was about 7.53%.
[0088] See Table 2 for the reproduction status of the F1-F3 generation rats, and the F2 generation TauT in multiple groups + / - See Table 3 for the statistics of rat self-breeding.
...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



