EBV (Epstein-Barr virus) detection kit
A technology of virus detection and kit, which is applied in the field of molecular biotechnology and genetic detection, can solve the problem of not being able to display the specific number of viruses in the active phase, and achieve the effect of fast and simple interpretation of results, low requirements for facility conditions, and avoiding cross-contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The EBV nucleic acid detection kit used in this example uses gold nano probes without LNA modification and gold nano probes containing LNA modification to verify the superiority of hybridization efficiency of LNA modified gold nano probes.
[0051] In this embodiment, the EBV nucleic acid detection kit is composed of a pair of primers, an upstream probe, a downstream probe, a hairpin probe, a pair of nano gold probes, a reaction solution and an enzyme solution. The primers and probes The sequence is shown below.
[0052] Upstream primer: GCTAAGCCCAACACTCCACCAC (SEQ ID NO: 1);
[0053] Downstream primer: CCTTCTTAGGAGCTGTCCGAGGG (SEQ ID NO: 2);
[0054] Upstream probe: ACCCAGGCACACACTACACT (SEQ ID NO: 3);
[0055] Downstream probe: CGCGCCGAGGACACCCACCCGTC (SEQ ID NO: 4);
[0056] Hairpin probe: TTG GTC TGG TGC TAC ACT CGT CTC GGT TTT CCG AGA CGA GTC CTCGGC GCG ATC GTG ATG AAC CAT (SEQ ID NO: 5);
[0057] Nano gold probe 1: Au-TTTTTT-ATG GTT CaT CAC GAT (SEQ ID NO: 6);
[0058] Nano g...
Embodiment 2
[0061] Example 2 Optimization of EBV nucleic acid detection method
[0062] In this example, the EBV nucleic acid detection kit is used to detect the EBV plasmid template and the negative reference respectively, and different data processing methods are verified to achieve better discrimination of the detection results, and at the same time to meet the user's requirements in a better way. Get used to and enhance the user experience of the test kit.
[0063] The reagent kit has a volume of 20μL, and its components are: 10mM Tris buffer (pH 8.5), 1μM primers (upstream primer, downstream primer), 1μM probe (upstream probe, downstream probe, hairpin probe) ), 0.05μM gold nanoprobe (nano gold probe 1, nano gold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AfuFEN. Add 10 to the system sequentially 5 And 0 copies of the nucleic acid to be tested (the template sequence is shown in SEQ ID NO: 8). The reaction system is composed of a reaction program: 95°C, 20s; 99°C, 2s,...
Embodiment 3
[0067] Example 3 Sensitivity of EBV nucleic acid detection reagent
[0068] In this example, the EBV nucleic acid detection kit was used to detect EBV plasmid templates of different concentrations to verify the feasibility of the method of the present invention.
[0069] The reagent kit has a volume of 20μL, and its components are: 10mM Tris buffer (pH 8.5), 1μM primers (upstream primer, downstream primer), 1μM probe (upstream probe, downstream probe, hairpin probe) ), 0.05μM gold nanoprobe (nano gold probe 1, nano gold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AfuFEN. Add 10 to the system sequentially 5 , 10 4 , 10 3 , 10 2 , 10, 1 and 0 copies of the nucleic acid to be tested (the template sequence is shown in SEQ ID NO: 8). The reaction system is composed of a reaction program: 95°C, 20s; 99°C, 2s, 70°C, 30s, 35 cycles; 63°C, 10min; 55°C, 5min. After the reaction, the result is shown in figure 2 in. figure 2 The results show that the kit of the present i...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



