Application of long-chain non-coding RNA IncMGPF in regulation and control of muscle development functions of pigs
A long-chain non-coding, lv-lncmgpf technology, applied in the field of improving pig muscle mass, can solve the problem of less lncRNA identification, achieve low cost, improve production efficiency, and shorten the cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Isolation and culture of porcine skeletal muscle satellite cells
[0052] Take a 1-day-old piglet (for example, the breed is Large White pig, but not limited to this breed) to kill by bleeding from the common carotid artery, and immerse it in 75% ethanol for 10 minutes to kill bacteria. Peel off the hindlimb muscles exposed by piglet skin, cut the muscle tissue with ophthalmic scissors, place 2% double antibody in phosphate buffered saline (PBS, dissolve 8g of NaCl, 0.2g of KCl, 2.89g of KCl in 750ml of ultrapure water Na 2 HPO 4 12H 2 O, 0.2 g NaH 2 PO 4 , dilute pure water to 1000mL) solution, rinse to remove hair, blood and fat. In the PBS solution with a double antibody concentration of 2%, thoroughly mince the muscle to 1mm 3 size. Collect in a 15mL centrifuge tube and centrifuge at 5000r / min for 2min. The PBS solution was discarded, and depending on the amount of muscle tissue precipitate, 2 times the volume of 2% collagenase was added, and the ...
Embodiment 2
[0053] Embodiment 2: Use RACE method to amplify and determine lncMGPF and its nucleotide sequence
[0054] Using porcine skeletal muscle satellite cell cDNA as a template, the RACE Rapid Amplification Kit of Takara Bioengineering Dalian Co., Ltd. (TAKARA) was used to operate according to the kit instructions. Design lncMGPF primers: 5'RACE primer: 5'-CCTGCCTCAAACCCCTCCTTTTACTCATCA-3', 3'RACE primer: 5'-ATTGCCAGCATTTGTAAGTGATTGTGCAAT-3'. The obtained amplified products were subjected to agarose gel electrophoresis, and the target bands were recovered and sequenced. The test results show that: through 5'RACE and 3'RACE amplification, the results show that the obtained sequence lncMGPF has a full length of 1586bp (see the sequence listing SEQ ID NO: 1 for its nucleotide sequence).
Embodiment 3
[0055] Example 3: Construction of lncMGPF overexpression and interfering lentiviral vector
[0056] Using pig skeletal muscle satellite cell cDNA as a template, design amplification primers according to the RACE sequencing results of Example 2, lncMGPF amplification full-length primers are as follows: forward primer F: GCTCTAGAGCAGAGCATTATTTTTCTTCTTCA; reverse primer R: CGGGATCCCGTGGCATTTACTTTTACTGGA.
[0057] Design siRNA sequence for lncMGPF nucleotide sequence, siRNA sequence primer is as follows: Forward primer F: CCGGAAGCATGAGGTCACTTAATATCTCGAGATATTAAGTGACCTCATGCTTTTTTTG; Reverse primer
[0058] R: AATTCAAAAAAAGCATGAGGTCACTTAATATCTCGAGATATTAAGTGACCTCATGCTT.
[0059] The amplified full-length lncMGPF sequence was connected to a lentiviral vector to obtain an overexpression vector PCDH-CMV-copGFP, which was named LV-lncMGPF. Further, the synthesized siRNA sequence was connected to the pLKO.1-TRC vector, and the recombinant vector was named LV-si-lncMGPF.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



