Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 site based on probe method
A primer composition, probe method technology, applied in biochemical equipment and methods, microbial determination/inspection, recombinant DNA technology, etc. The effect of strong processing capacity, low pollution risk and low price
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention.
[0035] The primer composition for realizing the accurate typing of the vitamin D receptor Fok1 site based on the probe method includes:
[0036] VDR gene Fok1 (rs2228570) forward amplification primer:
[0037] CTGGCCCTGGCACTGACTCTGGCTCT (corresponding to SEQ No.1 in the sequence listing);
[0038] VDR gene Fok1 (rs2228570) reverse amplification primer:
[0039] GGTCAAAGTCTCCAGGGTCAGG (corresponding to SEQ No.2 in the sequence listing);
[0040] VDR gene Fok1 (rs2228570) genotype T probe:
[0041] 5'-CTTACAGGGATGGAG-3' (corresponding to SEQ No.3 in the sequence listing);
[0042] VDR gene Fok1 (rs2228570) genotype C probe:
[0043] 5'-CTTACAGGGACGGAG-3' (correspo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



