Survivin-whole-antigen-targeted DC cells, CTL cells, preparation method therefor and application of CTL cells
A whole antigen and cell technology, applied in the direction of genetically modified cells, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of high economic expenditure, no survivin expression, poor efficacy, etc., and achieve high-efficiency expression Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035]Example 1, DC cells and target cells loaded with Survivin antigen
[0036] In this example, DC cells and target cells loaded with Survivin whole antigen (amino acid sequence shown in SEQ ID No. 2) were prepared according to the following operations.
[0037] 1. Design primers, clone Survivin gene by PCR, and construct lentiviral vector
[0038] (1) According to the Survivin nucleic acid sequence (SEQ ID No. 1) published in NCBI nucleotide, in the present invention, primers were designed and synthesized by a third party. The designed primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 4.
[0039] Survivin nucleic acid sequence (SEQ ID No. 1):
[0040] ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGA...
Embodiment 2
[0090] Example 2, DC-Survivin induces and expands immune cells
[0091] In this implementation, DC-Survivin is used to induce and expand immune cells, and the preparation process mainly includes:
[0092] (1) Take the antigen-loaded DC cells and autologous PBMC cells and count them.
[0093] (2) Use X-VIVO medium containing 5% human serum, mix DC cells and PBMC cells according to the amount of DC cells:PBMC=1:5~1:500, and culture overnight.
[0094] (3) The next day, add 200~1000unit / ml interleukin 2 to the culture system, mix and culture.
[0095] (4) Add appropriate amount of medium and interleukin 2 according to the growth status of the cells.
[0096] (5) On day 12-14, some cells were collected for flow cytometric analysis.
[0097] (6) Take 1-5×10 5 cells, centrifuged at 2500rpm for 5min.
[0098] (7) Wash twice with PBS, centrifuge at 2500rpm for 5min.
[0099] (8) Add 100 μl BSA-containing blocking solution to the cells, and block on ice for 10-15 minutes.
[010...
Embodiment 3
[0118] Example 3, the killing effect of Survivin antigen-specific CTL cells on target cells
[0119] In this example, the killing effect of Survivin antigen-specific CTL cells on target cells was investigated. Related methods include the following operations:
[0120] (1) Digest target cells 3T3L / Survivin, 3T3L / 2402 / Survivin, 3T3L / 224 / Survivin, count, inoculate 5x104 cells / well in a 24-well plate, and adhere to the wall for 2-3 hours;
[0121] (2) For cell counting, effector cells were added to target cells according to the effector cell:target cell ratio of 1:1, 2:1, 5:1 and 10:1 respectively, and mixed culture for 4 hours;
[0122] (3) Discard the suspended T cells, wash gently with PBS for 1-3 times to remove floating dead target cells, and blot the liquid in the well;
[0123] (4) Add 100 μl of cell lysate to each well and lyse on ice to release the luciferase protein from the cells;
[0124] (5) Transfer the lysate to a 1.5ml EP tube, centrifuge at 3000rpm for 3min;
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



