Bemisia tabaci MED cryptic species chromatin remodeling factor Btbrm2 as well as encoding gene and application thereof
A technology of Bemisia tabaci and chromatin, applied in the field of agricultural biology, can solve problems such as unknown functions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Cloning of full-length cDNA sequence of Bemisia tabaci MED hidden Btbrm2 gene
[0025] Take 200 Bemisia tabaci adults under different temperature stress conditions and put them into a 1.5mL centrifuge tube. After freezing in liquid nitrogen, they are ground into powder with a grinding rod, and then RNA is extracted and stored at -80°C for later use. According to the instructions of the One-Step gDNA Removal and cDNA Synthesis SuperMix, the extracted RNA was reverse transcribed to synthesize cDNA. Using cDNA as a template, design primers for PCR amplification. The designed primers are shown in Table 1 and Table 2:
[0026] Table 1
[0027]
[0028] Table 2
[0029]
[0030] The experiment found that, using the primers in Table 1, PCR amplification was used to obtain the full-length cDNA of the Bemisia tabaci MED cryptic Btbrm2 gene. Using the primers in Table 2, the target gene sequence cannot be obtained.
[0031] Using the sequence in Table 1, amplified by PCR, th...
Embodiment 2
[0032] Example 2: Analysis of the expression characteristics of Btbrm2 gene
[0033] (1) Extract RNA and synthesize cDNA from adults of Bemisia tabaci under different temperature stress
[0034] The newly emerging Bemisia tabaci MED cryptic species and Asia II 1 cryptic species adults were selected, and the Bemisia tabaci adults were subjected to stress treatments at 0, 12, 26, 35, and 40 ℃, respectively. Three biological replicates each, a total of 3000 adults, immediately placed in liquid nitrogen after the end of the stress, frozen for 3 minutes and then stored at -80 ℃. According to the method of Example 1, RNA was extracted and reverse transcribed into cDNA.
[0035] (2) Fluorescence quantitative PCR to detect the expression of Btbrm2 at different temperatures:
[0036] Design primers for the Btbrm2 gene and two internal reference genes (EF1-α, β-tublin) for fluorescent quantitative PCR:
[0037] brm2-QF: AAAACCATCCAAACAATCGC
[0038] brm2-QR: TTTCAAACTCCAACACCCAA
[0039] EF1-α-F:...
Embodiment 3
[0048] Example 3: Analysis of the effect of Btbrm2 gene on temperature tolerance of Bemisia tabaci MED cryptic species
[0049] 3.1 Synthesis of dsRNA
[0050] (1) Design and synthesize the primer sequence with T7 promoter (sequence shown underline):
[0051] T7+Btbrm2-F: 5’- TAATACGACTCACTATAGGG TGTGATATGTCAGGGCT-3’
[0052] T7+Btbrm2-R: 5’- TAATACGACTCACTATAGGG TACTCGGTGATTGGTGG-3’. Synthesized by Shanghai Shenggong Biological Engineering Technology Service Co., Ltd.
[0053] (2) Total RNA extraction and cDNA synthesis: same as in Example 1.
[0054] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for dsRNA synthesis. Use the kit to synthesize and purify dsRNA, and follow the kit instructions.
[0055] 3.2 dsRNA feeding
[0056] Parafilm membranes were pre-treated with DEPC water to remove RNase. Add dsRNA to the 10% sucrose solution at a concentration of 0.3-0.5μg / μL. According to the feeding characteristics of Bemisia tabaci, t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



