2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and detection method
A 2019-ncov, constant temperature amplification detection technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, resistance to vector-borne diseases, etc., can solve the problem of high technical requirements for operators and the inability to screen large-scale populations , can not be promoted and used at the grassroots level, and achieve the effects of saving experimental time, fast constant temperature amplification, and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0040] Embodiment: A 2019-nCoV nucleic acid constant temperature amplification detection kit based on SYBR Green I described in this embodiment of the present invention includes 2019-nCoV virus primers and SYBR Green I; 2019-nCoV virus primers include ORF1ab gene Primers and N gene primers, the ORF1ab gene primer sequences are shown as ORF1ab-F and ORF1ab-R; the N gene primer sequences are shown as N-F and N-R.
[0041] The primer sequence list is:
[0042] ORF1ab gene:
[0043] AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTT TACACTTAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA
[0044] ORF1ab gene primer sequence: ORF1ab-F:
[0045] TAATACGACTCACTATAGGGCCCTGTGGGTTTTACACTTAA
[0046] ORF1ab gene primer sequence: ORF1ab-R:
[0047] TAATACGACTCACTATAGGGACGATTGTGCATCAGCTGA
[0048] N gene:
[0049] GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGG GAGCCTTGAATACAC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



