ELISA kit for detecting salmonella antibody, detection method and application thereof
A Salmonella detection method technology, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of insufficient food safety, high requirements for operators, expensive kits, etc. problem, to achieve the effect of easy observation, good repeatability and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Embodiment 1, the establishment of detecting Salmonella ELISA method
[0049] 1. Preparation of Salmonella invA recombinant protein
[0050] 1. Construction of recombinant vector expressing Salmonella invA recombinant protein
[0051] According to the gene sequence of Salmonella ATCC43973 in GenBank (GenBank: MK017931.1), use Primer5.0 software to design specific primers:
[0052] F: ATTGTCACCGTGGTCCAGTTTATCG (SEQ ID NO. 3)
[0053] R: CTTCATCGCACCGTCAAAGGAA (SEQ ID NO. 4)
[0054] The size is 216bp, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0055] Take the frozen bacterial liquid, extract bacterial DNA according to the bacterial DNA kit, and store it at -20°C for invA gene amplification. PCR amplification was carried out with bacterial DNA as template and F and R as primers.
[0056] The PCR amplification system is shown in Table 1:
[0057] Table 1 PCR amplification system
[0058]
[0059] The reaction conditions were: pre-denaturation at 94...
Embodiment 2
[0106] Embodiment 2, the evaluation of detection Salmonella antibody ELISA method
[0107] 1. Specificity test
[0108] Escherichia coli positive serum, Staphylococcus aureus positive serum, Clostridium welchii positive serum, Haemophilus paragallinarum positive serum, Pasteurella positive serum, Anapest Rimmer were detected according to the ELISA method of detecting Salmonella antibody in Example 1 Salmonella positive serum; the Salmonella positive serum and Salmonella negative serum were used as controls to judge the specificity of the ELISA method.
[0109] The results are shown in Table 4, P / N of Escherichia coli positive serum, Staphylococcus aureus positive serum, Clostridium welchii positive serum, Haemophilus paragallinarum positive serum, Pasteurella positive serum, Riemerella anatipestifer positive serum The values are all less than 2, indicating that the established ELISA method has no cross-reaction with other bacterial sera and has good specificity.
[0110] T...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



