SlugCas9-HF protein, gene editing system containing SlugCas9-HF protein and application thereof
A gene editing, cas9-hf technology, applied in applications, genetic engineering, plant genetic improvement, etc., can solve problems such as ineffective packaging, complex PAM sequences, and limited applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] A CRISPR / Cas9-HF gene editing system, comprising SlugCas9-HF protein and sgRNA, the sgRNA is respectively adding 21 bases AGAGTAGGCTGGTAGATGGAG, GTCAGACATGAGATCACAGAT at the front end of the nucleotide sequence shown in SEQ ID NO:3, The sequences of the obtained nucleotide sequence M are specifically shown in SEQ ID NO:5 and SEQ ID NO:6.
[0086] The application of the above-mentioned CRISPR / Cas9-HF gene editing system to gene editing of targeted DNA in HEK293T cells containing targeted DNA, specifically includes the following steps:
[0087] (1), construction of plasmid pAAV2_SlugCas9-HF_ITR
[0088] ①According to the retrieval number A0A133QCR3 of the SlugCas9 gene on UniProt, download its amino acid sequence, and make R247A, N415A, T421A, R656A mutations. After the mutation, the amino acid sequence encoding the SlugCas9-HF protein is shown as SEQ ID NO:1;
[0089] ② Codon-optimizing the amino acid sequence encoding the SlugCas9-HF protein obtained above to obtain a ...
Embodiment 2
[0130] A CRISPR / Cas9-HF gene editing system, including SlugCas9-HF protein and sgRNA (hereinafter referred to as On-target sgRNA, to distinguish it from mismatch sgRNA), and also includes sgRNA containing different base mismatches, namely mismatchsgRNA;
[0131] The SlugCas9-HF protein has the amino acid sequence shown in SEQ ID NO:1;
[0132] The On-target sgRNA is a nucleotide sequence M obtained by adding 21 bases (GGCTCGGAGATCATCATTGCG) to the front of the nucleotide sequence shown in SEQ ID NO: 3, specifically referring to SEQ ID NO: 7.
[0133] Using one of the above-mentioned CRISPR / Cas9-HF gene editing systems to detect its specificity in the GFP reporter system HEK293T cell line containing targeted DNA, and then count the percentage of GFP-positive cells to calculate the editing efficiency and off-target rate, specifically including the following steps:
[0134] (1), construct the plasmid pAAV2_SlugCas9-HF_ITR, the same as the step (1) of Example 1, until the plasmid pA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



