High-yield influenza virus preparation system and preparation method
An influenza virus, high-yield technology, applied in the high-yield influenza virus preparation system and the field of preparation, can solve the problem that the threat of influenza virus cannot be completely eliminated, and achieve the effects of increasing the titer of toxin production, increasing the yield, and optimizing the preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Establishment of MARCH8-deleted MDCK cells
[0039] 1. Method
[0040] 1.1 Establishment of MDCK cell lines lacking MARCH8
[0041] 1.1.1 Construction of lentiCRISPR-gMARCH8 plasmid
[0042] For the MARCH8 gene, design gRNA sequences through the website http: / / www.e-crisp.org / E-CRISP / , including gMARCH8#1 and gMARCH8#2.
[0043] gMARCH8#1 sequence: GTAAGACCAAAGAAAAGGAG
[0044] gMARCH8#2 sequence: GAGCTCGCAGCAGCGCGTGT
[0045] Two gRNA sequences targeting MARCH8 were introduced into lentiCRISPR-V2 by molecular cloning to obtain the lentiCRISPR-gMARCH8 plasmid.
[0046] 1.1.2 Preparation of pseudoviruses for transduction
[0047] HEK293T cells (4×10 6 ) were inoculated in a 10 cm culture plate and cultured overnight, when the cell growth density reached 60% to 70%, transfected with VSV-G, pSPAX2 plasmid and lentiCRISPR-gMARCH8 or lentiCRISPR-V2 control plasmid. After 48 hours, the pseudovirus supernatant packaged with CRISPR-gMARCH8 was harvested, centri...
Embodiment 2
[0057] Example 2 Construction of M2 mutants to obtain high-yield strains not affected by MARCH8
[0058] 1. Method
[0059] 1.1 Detection of M2 protein expression
[0060] 1.1.1 Influenza virus infection
[0061] In HEK293 (5×10 5 ) cells were transfected with MARCH8 or control plasmid Vector for 24 hours; infected with A / PR8 virus (MOI=2.0) for 8 hours.
[0062] 1.1.2 Western Blot detection of M2 total protein expression
[0063] Collect infected cells, centrifuge at 3000rpm for 3min, wash once with PBS, add 100μL cell lysate RIPA, and store at -20°C for later use. Protein samples were prepared and subjected to SDS-PAGE electrophoresis, and Western Blot was used to detect the expression of M2 protein.
[0064] 1.1.3 Flow cytometry to detect the expression of M2 protein on the plasma membrane
[0065] Collect infected cells, centrifuge at 3000rpm for 3min, wash once with PBS, bind M2 antibody at 4°C for 1h, wash once with cold PBS, Alexa Combine the goat anti-mouse flu...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Titer | aaaaa | aaaaa |
| Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



