Antisense oligonucleotide of METTL3 and application of antisense oligonucleotide in prostate cancer
An antisense oligonucleotide and prostate cancer technology, applied in the field of antisense oligonucleotide and its application in prostate cancer, can solve the problems that oligonucleotide drugs have not been reported, research has not been reported, etc. Achieve the effect of recovery sensitivity and high knockout efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0127] Example 1 Effect of METTL3 on castration-resistant prostate cancer cell line C4-2 and LNCap-AI on enzalutamide resistance
[0128] Use lentivirus to transfect the vector carrying the sh-METTL3 sequence and puromycin resistance gene, based on LNCAP-AI and C4-2 cell lines, after transfecting the virus, culture the cells for one week, and use puromycin to screen to obtain METTL3 knockdown stable cell line.
[0129]The control cells and knockdown cells were plated in 96-well plates (n=5) and 6-well plates, respectively, with 2000 cells per well, and enzalutamide and DMSO were administered, respectively.
[0130] For 96-well plates, place at 37°C, 5% CO 2 Culture in an incubator, and take out a 96-well plate every 24 hours. Use PBS solution or normal saline as a solvent, and prepare a tetramethylazoazole (MTT) solution with a final concentration of 5 mg / ml. Add 10 μl of MTT solution to each well, and place again at 37°C, 5% CO 2 Incubate for 2 hours in the incubator. Tw...
Embodiment 2
[0133] Example 2 Expression of METTL3 in drug-resistant castration-resistant prostate cancer cell lines
[0134] 1. Construction of enzalutamide-resistant castration-resistant prostate cancer cell lines
[0135] Prostate cancer cell line C4-2 was cultured in RPMI-1640 medium with 10% fetal bovine serum, and different concentrations of enzalutamide (5 μM, 10 μM, 20 μM, 40 μM) were gradually added to the medium. Cells were cultured in a cell incubator at 37°C, 5% CO 2 . During the culture process, it is determined whether to perform cell replacement and cell passage according to the actual growth of the cells. When the cells are cultured to 40 μM enzalutamide, the growth and proliferation rate is the same as that of the primary C4-2 in 10% fetal bovine serum RPMI- The 1640 medium is roughly the same.
[0136] Using a microscope to observe the drug-resistant cells and the original cells can be seen to have significant morphological differences ( figure 2 ).
[0137] 2. MTT ...
Embodiment 3
[0142] Design and detection of the antisense oligonucleotide of embodiment 3METTL3
[0143] 1. Biological identification of ASO sequences and comparison of modification schemes and sites
[0144] Use the BLAST biological serial information primary structure online comparison tool in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to compare and analyze the mRNA structure information of each transcript of Mettl3 mRNA, and record it consensus sequence. Use the "soligo" page (http: / / sfold.wadsworth.org / cgi-bin / index.pl) in the sfold RNA secondary structure online prediction tool to input the consensus sequence of each transcript of Mettl3, and select the oligo length as 20nt. Submit and record screening results.
[0145] All ASO sequences (Table 1) were purchased from the company (Sangko Sagon) and only basic modifications were used (Table 2).
[0146] Table 1 ASO sequence
[0147] ASO sequence serial number GGTGTAGCAACTTCTTTCTCT SEQ ID NO.1 TCTTTTCTGC...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com