Secretory expression for human insulin gene in methyl alcohol yeast
A technology of human insulin and methanol yeast, applied in the field of genetic engineering, can solve problems such as low expression level, and achieve the effects of increasing yield, simple process and shortening working hours
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0060] The present invention will be further described below in conjunction with embodiment, as shown in Figure 5, the present invention specifically comprises the following steps:
[0061] Step 1: Construction of expression plasmid pPIC9K(+B+A):
[0062] 1. Preparation of plasmid pPIC9K (B-C'-A) containing 2-peptide C-chain human proinsulin (B-C'-A).
[0063] The molecular biology operations involved in the present invention are all carried out according to conventional classical methods (Ausubel, F.M., et al., Short Protocols in Molecular Biology Second Edition, 1992).
[0064] a) Preparation of B-C'-A DNA fragment: using the yeast preferred codon human proinsulin (C') sequence (Figure 1). Synthesize the following two single-stranded DNA fragments of similar primers at Integrated DNA Technologies, Inc. in the United States:
[0065] 5'-USAp (100nt)
[0066] 5'- GCATTACGTA TTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTT TCTTTCTACACTCCAA AGACT
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



