Mosaic vaccine of Ag85B and ESAT-6
A vaccine, subunit vaccine technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1 Ag85B, the preparation of the chimeric subunit vaccine of ESAT-6
[0035] 1.1 Preparation of genomic DNA of Mycobacterium tuberculosis H37Rv strain
[0036] Mycobacterium tuberculosis (H37Rv) was cultured in 7H9Broth medium for 4 weeks at 80°C for 2 hours to inactivate. Genomic DNA was extracted with a bacterial DNA (miniature) extraction kit. Due to the thick wall of TB bacteria, the digestion time of the bacteria is extended to 3 to 5 hours.
[0037] 1.2 Amplification of Mycobacterium tuberculosis H37Rv strain ag85b, esat-6 gene
[0038] Primers were designed according to the ag85b, esat-6 gene and the multiple cloning site of the vector. Primers were designed as follows:
[0039] ag85b:
[0040] Upstream: 5'TAAGAATTCTTCTCCCGGCCGG-G 3'EcoRI
[0041] Downstream: 5'TAAGCGGCCGCTCAGCCGGCGCCT 3'NotI
[0042] esat6:
[0043] Upstream: 5'TAATCGCGATGACAGAG-CAGCAGTG 3'NruI
[0044] Downstream: 5'TAACTCGAGGCGAACATCCCAGTGA3'XhoI
[0045] PCR reaction system:...
Embodiment 2
[0052] Example 2 Vaccine immunization of mice and determination of immune indexes
[0053] Using Ag85B, the chimeric subunit vaccine of ESAT-6 (referred to as A N -E-A C ) and the adjuvant MPL-TDM to co-immunize C57BL / c mice, and at the same time, the fusion subunit vaccine of Ag85B-ESAT-6 (abbreviated as A-E) and Tris-MPL (ie monophospholactone A)-TDM (ie trehalose disopyramide mycolate) as a control. Vaccines were given once every two weeks for a total of three immunizations. After immunization, blood was collected to detect the expression level of serum antibody by ELISA method. Spleen was isolated aseptically, and the expression of IFN-γ after spleen cells were stimulated by the corresponding protein was detected by ELISPOT technique. They respectively reflect the levels of humoral immunity and cellular immunity after vaccine immunization. The result shows: Ag85B, the chimeric subunit vaccine of ESAT-6 and the fusion subunit vaccine group of Ag85B-ESAT-6 compare, the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
