Human-like collagen gene, homodirection tandem gene with different repeat numbers, recombinant plasmid having tandem gene and preparation method
A human-like collagen and recombinant plasmid technology, applied in the field of genetic engineering, can solve the problems of difficult product purification, imperfect processing and modification system, long production cycle, etc., to achieve easier success and avoid difficult primer design and condition exploration work , a feasible effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The base sequence of the human-like collagen gene of the present invention is as shown in SEQ ID NO: 1 in the sequence listing, namely:
[0032] agaggtccacccggtgagccaggtaacccaggttctccaggaaaccaaggtcaacctggaaacaagggttctcctggaaacccaggtcaacctggtaacgagggacaaccaggtcaacctggtcaaaacggtcaaccaggtgagcctggatctaacggtcctcaaggttcccaaggtaacccaggtaagaacggtcaaccaggttctccaggttcccaaggttctcctggaaaccaaggttctccaggtcaaccaggtaacccaggtcaacctggagagcaaggtaagccaggtaaccaaggtccagccggtggttaaagaa
[0033] The nucleic acid length is 322bp, named Gel.
[0034] combine figure 1 , the present invention contains the above-mentioned recombinant plasmid of human-like collagen gene. The human-like collagen gene Gel was cloned into the SmaI site of plasmid pUC57, and the resulting recombinant plasmid was named pUC57Gel. The results of EcoRI single-digestion electrophoresis of the recombinant plasmid pUC57Gel are shown in the appendix figure 1 Lane 2, where lanes 1 and 5 are DNA molecular weight standard DL150...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
