Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof
A bioreactor and human interleukin technology, applied in biochemical equipment and methods, botany equipment and methods, interleukin, etc., to achieve the effects of shortened time, simple preparation process, high transposition and purification rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Preparation of Bombyx mori larvae expressing hIL-28A
[0025] 1. According to the cDNA sequence of hIL-28A published by GenBank (GenBank accession number: BC113583), the coding sequence of hIL-28A gene was synthesized and cloned into T-vector to obtain pUC-hIL-28A plasmid.
[0026] 2. Design and synthesize primer pair IL-28A-1 (TA GGATCC ATGAAACTAGACATGAC, the underline is the BamH I site) and IL-28A-2 (TT GAATTC AGACACACAGGTCCCCACTG, the underline is the EcoR I site). Using the pUC-hIL-28A plasmid as a template, digest it with BamH I / EcoR I double enzymes, recover the hIL-28A fragment, and connect it with the donor plasmid pFastBac-Dual (Invitrogen Company) digested with the same enzyme to obtain the pFastBac-Dual-hIL28A plasmid , the plasmid transformed Escherichia coli BmDH10Bac competent cells, coated with tetracycline (10 μg / ml), kanamycin (50 μg / ml), gentamicin (7 μg / ml), IPTG (40 μg / ml), X -gal (100μg / ml) LB agar culture plate. Pick white colony ...
Embodiment 2
[0030] Example 2: Preparation of silkworm chrysalis expressing hIL-28A
[0031] 1. Use the recombinant virus BmNPV-hIL-28A obtained in step 3 of Example 1 to infect BmN cultured cells, and collect the cell culture supernatant after 4 days.
[0032] 2. Take the cell culture supernatant of step 1 with an insect needle, puncture and inoculate the silkworm chrysalis before compound eye coloring, protect it at about 25°C for 5 days, and take a small amount of silkworm blood. IL-28A ELISA kit (USCN and LIFETECHNOLOGY company) was used to measure the expression level of hIL-28A, and the amount of recombinant hIL-28A per milliliter of hemolymph reached 33 μg. The silkworm pupae were collected 5 days after virus inoculation and stored at -20°C.
Embodiment 3
[0033] Example 3: Preparation of lyophilized powder of silkworm chrysalis expressing hIL-28A
[0034] 1. Get 5 kg of silkworm chrysalis from Step 2 of Example 2, homogenate in an ice bath, add 20 kg of 0.7% physiological saline, mix well, and filter with gauze to remove coarse impurities.
[0035] 2. The filtrate was lyophilized into a powder material, and ELISA assay showed that each gram of the lyophilized powder contained 8.5 mghIL-28A.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
