Method and kit for determination of human POT1 gene rs1034794 site polymorphism
A locus polymorphism and gene technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem of high price, and achieve the effect of lower measurement cost, good yield and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1 Determination of rs1034794 polymorphism by extracting DNA from human peripheral blood leukocytes
[0060] 1 Materials and methods
[0061] 1.1 Main reagents and instruments
[0062] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction endonuclease AluI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.
[0063] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).
[0064] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested
[0065] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-...
Embodiment 2
[0090] Example 2 Determination of rs1034794 polymorphism in human peripheral blood whole blood samples
[0091] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.
[0092] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:
[0093] Upstream primer: 5'TCTGTTTAACATGCAAGAATTATATTCAAACTTCAGGATCAAG3' (SEQ ID NO: 7);
[0094] Downstream primer: 5'TGTATATCATAGATGGAATAGACCT3' (SEQ ID NO: 8)
[0095] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration: 0.1-1 μM), 2×PCRMix 10 μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reaction system, and adjust the pH of the solution to about 7.3.
[0096...
Embodiment 3
[0109] The genotype judgment after AluI digestion was the same as in Example 1. A total of 96 cases were detected, and the results showed that 21 cases of TT type, 38 cases of AT type and 37 cases of AA type were found at the rs1034794 locus. Example 3 Determination of rs1034794 polymorphism in human peripheral blood clot specimen
[0110] The main reagents are the same as in Example 1 except that the endonuclease is CviKI-1; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.
[0111] The upstream primer used in the PCR reaction is SEQNO:10, and the downstream primer is SEQNO:11.
[0112] Upstream primer: 5'TCTGTTTAACATGCAAGAATTATATTCAAACTTCAGGATCAAGC3' (SEQ ID NO: 11);
[0113] Downstream primer: 5'TATCATAGATGGAATAGACC3' (SEQ ID NO: 12)
[0114] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
